%PDF-1.4 % 421 0 obj <> endobj xref 421 146 0000000016 00000 n 0000004164 00000 n 0000004337 00000 n 0000004363 00000 n 0000004434 00000 n 0000004491 00000 n 0000004852 00000 n 0000005033 00000 n 0000005215 00000 n 0000005397 00000 n 0000005579 00000 n 0000005761 00000 n 0000005920 00000 n 0000006060 00000 n 0000006229 00000 n 0000006385 00000 n 0000006525 00000 n 0000006662 00000 n 0000006814 00000 n 0000006991 00000 n 0000007168 00000 n 0000007324 00000 n 0000007485 00000 n 0000007698 00000 n 0000007777 00000 n 0000007855 00000 n 0000007935 00000 n 0000008014 00000 n 0000008093 00000 n 0000008171 00000 n 0000008250 00000 n 0000008330 00000 n 0000008410 00000 n 0000008490 00000 n 0000008570 00000 n 0000008650 00000 n 0000008728 00000 n 0000008807 00000 n 0000008886 00000 n 0000008964 00000 n 0000009042 00000 n 0000009121 00000 n 0000009201 00000 n 0000009280 00000 n 0000009359 00000 n 0000009438 00000 n 0000009516 00000 n 0000009595 00000 n 0000009674 00000 n 0000009753 00000 n 0000009831 00000 n 0000009909 00000 n 0000009986 00000 n 0000010064 00000 n 0000010142 00000 n 0000010220 00000 n 0000010297 00000 n 0000010375 00000 n 0000010452 00000 n 0000010529 00000 n 0000010607 00000 n 0000010684 00000 n 0000010762 00000 n 0000010840 00000 n 0000011137 00000 n 0000011768 00000 n 0000012144 00000 n 0000012523 00000 n 0000012984 00000 n 0000013151 00000 n 0000013728 00000 n 0000013905 00000 n 0000014094 00000 n 0000014294 00000 n 0000014678 00000 n 0000015137 00000 n 0000015406 00000 n 0000015508 00000 n 0000015924 00000 n 0000016313 00000 n 0000016514 00000 n 0000016809 00000 n 0000019417 00000 n 0000021765 00000 n 0000021944 00000 n 0000022012 00000 n 0000024340 00000 n 0000026284 00000 n 0000028486 00000 n 0000030576 00000 n 0000032616 00000 n 0000034606 00000 n 0000037593 00000 n 0000039405 00000 n 0000043282 00000 n 0000046697 00000 n 0000047367 00000 n 0000047867 00000 n 0000047975 00000 n 0000050065 00000 n 0000050353 00000 n 0000050684 00000 n 0000050890 00000 n 0000051305 00000 n 0000051508 00000 n 0000051803 00000 n 0000052289 00000 n 0000052413 00000 n 0000063457 00000 n 0000063495 00000 n 0000063974 00000 n 0000064088 00000 n 0000110577 00000 n 0000110615 00000 n 0000111089 00000 n 0000111201 00000 n 0000165525 00000 n 0000165563 00000 n 0000165664 00000 n 0000165720 00000 n 0000166160 00000 n 0000166256 00000 n 0000166376 00000 n 0000166519 00000 n 0000166618 00000 n 0000166743 00000 n 0000166860 00000 n 0000166999 00000 n 0000167104 00000 n 0000167239 00000 n 0000167407 00000 n 0000167635 00000 n 0000167798 00000 n 0000167888 00000 n 0000168004 00000 n 0000168121 00000 n 0000168262 00000 n 0000168395 00000 n 0000168526 00000 n 0000168693 00000 n 0000168878 00000 n 0000169089 00000 n 0000169300 00000 n 0000169503 00000 n 0000169738 00000 n 0000003216 00000 n trailer <<67DCB0161DBF7B49AF5E3BE49ABE7987>]>> startxref 0 %%EOF 566 0 obj<>stream xڤSMlW&MQ@~p? N`vJ 5vE`5k'mB(B@*rADVB Z[z}f̼}jقJ{1/ ?=ڏmmsE7tuUwڟY}lזUF}rO:9i__<INKg(iTswΎvYˮ:J}"?C\(ǔx O?ۖ~dq?S%̀)'X?/1NqYJ?ʼOԹ +s J{X$I2h̲vJ:gn!??fX{H3KC;Dn]?<{*H|OZl$'Kٗ8sH Hqb?{] ?Fu?JQ:aa߰ T??XmuSU?nRMO*LT?MmM ej}|K;|l~???߫P?ۄ)?`A`D??4! GVqLc򽿹 AGF+Ph7?BY?|{^AM3pAU[ɿSp_E>E endstream endobj 422 0 obj<> endobj 423 0 obj[424 0 R] endobj 424 0 obj<>>> endobj 425 0 obj<> endobj 426 0 obj<> endobj 427 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 428 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 429 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 430 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 431 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 432 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 433 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 434 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 435 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 436 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 437 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 438 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 439 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 440 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 441 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 442 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 443 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 444 0 obj<> endobj 445 0 obj<> endobj 446 0 obj<> endobj 447 0 obj<> endobj 448 0 obj<> endobj 449 0 obj<> endobj 450 0 obj<> endobj 451 0 obj<> endobj 452 0 obj<> endobj 453 0 obj<> endobj 454 0 obj<> endobj 455 0 obj<> endobj 456 0 obj<> endobj 457 0 obj<> endobj 458 0 obj<> endobj 459 0 obj<> endobj 460 0 obj<> endobj 461 0 obj<> endobj 462 0 obj<> endobj 463 0 obj<> endobj 464 0 obj<> endobj 465 0 obj<> endobj 466 0 obj<> endobj 467 0 obj<> endobj 468 0 obj<> endobj 469 0 obj<> endobj 470 0 obj<> endobj 471 0 obj<> endobj 472 0 obj<> endobj 473 0 obj<> endobj 474 0 obj<> endobj 475 0 obj<> endobj 476 0 obj<> endobj 477 0 obj<> endobj 478 0 obj<> endobj 479 0 obj<> endobj 480 0 obj<> endobj 481 0 obj<> endobj 482 0 obj<> endobj 483 0 obj<> endobj 484 0 obj<>/Font<>/ProcSet[/PDF/Text]/Properties<>/ExtGState<>>> endobj 485 0 obj<> endobj 486 0 obj<> endobj 487 0 obj<> endobj 488 0 obj<> endobj 489 0 obj<> endobj 490 0 obj<> endobj 491 0 obj<> endobj 492 0 obj<> endobj 493 0 obj<> endobj 494 0 obj<> endobj 495 0 obj<> endobj 496 0 obj<> endobj 497 0 obj<> endobj 498 0 obj<> endobj 499 0 obj<>stream Hbd`ab`dduvpvL)1K5M1JM6NKIe??g~ 1?2r?Zd` *??JV*ZZXIK0i`d``\Y\[_T_X_ZZTeZZRTX6bB }dQ`;ӹsTJf^?Y?6Wf??Chk`] endstream endobj 500 0 obj<> endobj 501 0 obj<>stream HTo w~ǫ:ҡKЫN58)RcC] r`Xc)AZQ㋉fFV_탃%lhByЀD{%.6,寴^Q:nbʜuݫ"C,s j endstream endobj 502 0 obj<>stream HWrT|m? $KubGfy?pP2?9=3 ʴmW 03=}?٪{jk> GbyD?mk[g??vΆ2mVgfs0-x6QI5[E[벶U m?. WNT$tcjz `CnyXLwyoV?^U?as. ~;o- MivO1VܴcYv{3vYV4{+ '͋ٮQG6Uޖ}c9F?I\?MhWMa3!D?-#NX~ $1?1qIh?c]?'do朱LFNMleIS~ԿzW \u4Y5HęznN^!?LCH'tRH#agrc=[$htk*??,a\:^{HL#'8I?B#re?g ƞp}R-OgWYc?LB b!ɅzSUz?B%"?KI$JK||jnXp\??ĜK0?i"O7v={լy@}"Hlfw,%ۼ+{?[uT~u::;wEiv~`maV`CJ)v૒R{¾?r(?_VS g8ꐚaBEI /|['?RCRi5~B1t_5--R?lrUVfMu+a_I?СmW謄N?yɔӀS_QFdF ox]ë?C)@?J-)5(E9f[P2:?]$#ADmą7urn?tY?ڮ/Wc?5wP?3?ƛCc,8LGF[? Vl#-zm?lGJ?+M\;?Jk,f,e & Jr⃒L&( T*Y?H]xG?a(??M͔?ǔCaq4@?b"T1v?Y㓅i:G3c?!Ee׷CXqR?ƪYb"'ݮz |sIΖyY?LpsTFp7svJ[HIA? :?;K^Q?RXa}iؐm-U0% ?[(gH?y]> m%sg??b4q K;>?T…YGiDIVۦk6^4j?Z&]>Oh סho??MxzpMC&J1DB?Go 'PqS4?*!ȮoDlpehjW HPy]Z '.Khb_o^?UZwT"X!}LOxv OmQRBf$Da}?Ƥ?z O ꢲtF]?M ~%F9C?OcKD INvsISuUIgps'}L#+?=5??Mu Ehe]lj}SCj?j^}P@׉8Rh??Ȱ<^i?/bzg ?i?בx,QQ?~ ]"/x8Wͩs Nި/ F?g~\7.E%??w.fdk]?{;cX<ۨP }%^z]QTJ׿ Tz3*&u1Sz?8?_.I:ҙ8W%WQYtd]OEE;t(U{oA̔QMsDd,=?M??Y??b.g U?]A#׶ut'hrTG}HCMr? Ժg/ endstream endobj 503 0 obj<>stream HWێ}țT`q~Al!ȃLqEnSݰoxZs6>2KF?tMf Q)m6ct]CG?Z&Qp`V"=S! paol p,v.,gʜ3,A>?dKT5i[_Nk7kQλ܋e<ÿ?$5gCx2I?U$2bjjUohpĕqt'SBrJp܅@?dg*{LC}#Iw~s? h?jv?.ݎ~>?c?Ż3Bw۝Nw*N 2?kQ.q7 Aw Y j;b% v]/S k/ RrY[z?-?\XEy~TqK FE{_?^IҌ<ƋF ]@0ŊV?j?B<&'i4^ān yt?Bl$¶p*t8[Ao!՗ZԪRqC#4m#uYO?}~B+]mi.Dc>؏M#Gpl۷?{f<֯?.2~%)Z0hzw?#IQp|YaWiJ6qλO~[;^tnu7DrА y^Y?H?N|V +wØHTq/H EɦuPjWJUŅ{']9Xl?̛g shے=??eq6dTsUvVP?E?_'?ٜr@8<;ȖPVcT whr}Gr ?qLj$+g4 `[!i@:/g߄ٔpi}P<-ÆVR8hJ6?2IV?]jKsh (vo40L#9Yb IHJA?飖 XV?H?ۙV)cQ^2Û?Ԅ֘?H?eў13C ??!~ARAM$? {A"?8?/IQG?^??I9(n"Ye?)1 y`v~|Bf<'H♳aF0Ѣ0YE̠S^{X.H"??tѿN hL$g&?H??d"0! dKLB4?mVPSxrAv9v~$Ho"r_"B~ՙs!vwsY8h?2yaZ}$p@@  qi??2~Q!c[V^&Ψ ƌR;W ښr?Dl7g H?s ?3ǵCjdK3?iB;> endobj 505 0 obj<> endobj 506 0 obj<>stream HW[SF+Q4{q†?qAhdP(6u?a&?Wѹ?*,aT.7D.?I?FH UvMJ$uoX¹HjقʔHAGEY#eLDiIa:R8RvhʔRyh?F 4g4cgpK *Ӕ{&?RRړ4U6=p$(q>'΄vS\ TzS"}m5uYty1?8JÔDiF5l& kiD#D2?h?Oi?6F$? =!yH51YͪC%僇f䤾/bt[?$o+6pލiaWE/Cs",weXqjtCnaٽCXmI^;}[??p?$NrfʟV?TOۚz?jPs "/?dMl+z[/3nJ_dmWUΓO%?le ?IxHfL. ?ghzۿf@{?[?]vzY@" ;p`Hɫ=FqKQ?A )ώ͛m=,w?UQ q^4fH낷{̺%c#2k)vlXIVT??-׳]qI1?9E״O?E5UU۬yF3Y~4QܶePEUeJնO:iA1B}rVo?Mnn5q lܓU;aX?F/˼\ Er֖P2\?XE`^ ^fy>d^I*k?~z^J~agۋmJ_F籬[i~a!H^?NH?P@CsM?QzO ~B/4>R殟;4?sߓ{M7 X*qZe(ߨ'Q}swjUΚ|?nq|yNc? )W4]%)5: 3%P ]h? |zwjbh?_Vj{RF^F ?ȯ]:|p"uLvsk?FU`#oב̝11ߵ3fd4zR?9X ?08wk.8ό ?Bd0U0o\D2? { rbԢ/%YQ~F:"; P?BR?M9uF2wgįW]`??S?qFg`1@P|pAQ WsFD0s?Ø?!g P?G΍߸#ch ?AG0wxdo a(fGqH#9Z"QD d 9 ljhn5^ endstream endobj 507 0 obj<>stream HtWI?9+-DIS? э&rC12N??v?e?Qeʘ{K^y؟Q'cKGLySq"ӉytUawR֍po ?Ae` +?Df tŶ(%c?~] q-O G8SXy?n ˉqb9A+? .Di>?f?ib`r—?ҲUBP`eNVkn'S1{M3:JVeϏv}B?FgAKѕЅ W?Fԩ%eTYL]_lj@VR?rdB/z!k?X`˶2dRbV-y-󒿌[Q?׉jonR]㩙ͪf_YuaDpk}Mxh?*SPڿƋ]Z?UO~ ]ZDtn* i ) :+Np܈NδnUeeYHo|?- eA[?0١䏾@=OVAg`r+uXOĀF6֗Ǿ P?Yx=@juVEPvjo&܈_D?M?aB,Fl@ӧ>m\(qAH?b\+dAYKZ;^Uvj;c&ڜ5rU8zRHڛx -=ᓮ? 0 endstream endobj 508 0 obj<>stream H|Wˮ5W DH?" !6L"8'>g"[5vL&M~w."Szڬݚ-y}K߷XLvdZ?aE3pd`TT|)Lqj4 qKR?lo71Bd^ dI?IzpNӜe. ۄpj2>{YbjLJ@a. ќ,),<'<[ rjk\> 16dM6T8FNQHp l>!F~Pc3CDBj??Wdh{'GOBE]?4)LLJx?w ^?P!?ursӚNtcwI:-?k_/?PbV"HЃQH?P(."?Ο`zs ?Wbd|ƅᲩKSqEoKn4]xJK?JK oujHBWM F?\l0IE.c?unE$U&? [`La{0_Qς aܘA?cs˅[J?-w'LA&biܭhvg?>l˜2jU?'9^vDu;d:?e?snL??? ?sX),+x9bf^i:n?^/βߦYDh8 ?ZZ_`xQKbvֽ?Q)ʲ?Ҭ ^ x?FysHuf9 $?,8ZF ??08]'Ȃ;?3s& tClv]+cn8QuR<`5V&Z̳W?&?hg֬e?f`kK]ksʽ XU4ΚAAΌP?Ed6jI c֔bF+mZ0oN4>yČĐ80N dnb?t c_=xDgNԁ/n?7 /mVqP,`<?ƺv^?_N?9x1 aJ̼ XAo!?`a_tv{?K|2t?>I1gјjC8NܶhfIc[SΝ fcz>?,.ßK ƄJT? ?A. L?E?E$[%B<˖v%2g96R -եv?f‚l?(Sj ?CcY?o/&UL8SfJĝI].37?Px5k0?rc͋TŔ16W&>-SfjOZ>qH, [E^M?2d>?,n΂- hh?;i0?h录9u7=?M??FaxGת,UulU8 ?/vK?)2JL??3J?%j| W݁wa}}HY?&88#ҭ`T.ϧ xuNYO<&;iOh endstream endobj 509 0 obj<>stream HlWIc)|C"AiY~r쪕4y0w {y{ ӲI6~ef? !?Յޔ잔ЭMQÛC#nXtSV\Wmޔ!s#4/mg?ͱ?8^0?s8%QoC+kN da [`\ U8~РD܎j=Њ+\}XyܗE& ?e?gHc_Q&ht?I%/J20 ʾ$c?N@??}|x? QEJ8 /?R??E?o|LX5  Tvn6(2jF?@h7 Ϻ??^~S~QQ AĂ!%&OV x]7M@I$D+^[?}?mGgVwSl.pCJM.ڤuw ~?'ĕmĭ'}{sx+z@"rҘIxS+b:iL;?? zu%6 ?)6⯔VCT? |w@Q݈ gAZ5Xpv?7)?Vzj?-?Ig3dA E児ν sWiPoƲ+!TKyd~~ZSJo,*?O?6ʢi?pĦW7^eXJ8vR)(E*  L *M5VftH *9ʂSsqCQx?ptavwΡ|_zʩg?KL(wvêWdk`mw@?57 ?ppV rb?9 s"Kp|!jS?lXFkE{V/Wc (m @Oy94ag|uW ^u$V<#?ZI SE@Pl3˚f f? rH}?(f?u[,ơ3_A)lH+s~gS8 7ߊNz$Hb#TاB(??g t{u]ǒW8?|œg N @:t ? tC??31p#?ǝjhɨ7Gry{𝮶(RvaΎNpʫXyiu?F7K}{|$1 >dGl6X *hg[?>5?P8?j׵uDB! :]Rv o*?]nGfL̓gN bu|'H^1vcgųrd0Kv\O?s6Ukhg+C¹2 \= sD)4??`,ld ?rG ȭI6 z8??X*c +?1ޠΌQn?7ް.˱GD!Hx3!7)oHi|xwQ)zbdq}(?m(%޷Cm?~7MɔqVcgOʷwAx4;/k|GF<()C?]ށaqO L?RwgS?:{\~S~.P??Tr%Ɔ Oc=(ï6ͪ⋯?PPq]PԠk??@I̺Xr 7bS`^W g?|?_?yj怜eP??E?v/%?ga??)9W{OHEHR} D~f@  ?Nu\ʵ"n]g%'x!19+5?]^`91V endstream endobj 510 0 obj<>stream HlWK;)[}L^u$-$H%R?m^[?^?߿bkEG;mK鱶e9?jSt>;,yx۞8qye6֠t?MOLl p*ԉDD? {I5dEX /Ά ?r=ˡ` ?&z1zrxg%@?b~^L|.x}h^xl{W[q&3;qc&]71Ȧ;P[W *PP+n RJbCğ2;OY;l(_^SzY|BNP ,ĎЄ|L*[)uteYZm^qc1*3D:AOǹx#M}?k\w[eSGnv?[֡%`uBٙq-?mr!wgarFOuHߗ°A?HhAE DX&v f?Ppz_E]ey?,h\>6x?UKZ\//h?@ӿnaڇ!?ZLX{YV?W@e8h{`DQÆbVI|{PAYlSNMε?i' A'޼UVP)?6 @.}(,LUx r~WCJƿ\$v ?>tT8YnXs&IN!GW\q?xOaBL7޺#nrH~7b|]C{bvx w,Bj?а'۔ȮRWDa!ԦVV?? Z?!EQ4{ sapE_jK^sM@%~94laX 4mg~Y a`h5F$@R?F^YVp݆TOP?L? %\3.Z>$8+w[|gtr͉XEUT>7Ԁ;ZMz&?D:Ձ. kngd_nd)p"t^'bp,e]??Q R}hl~T8Mmvjx3TM?-qY@Ϛ?iЅ?#9#ћ'?O; ]?z9ȃ= p) eѣn)`0HN?=vn?v9?`KG^F 2S5;ԇ0[Qǵ&̪?x1bVO~R}^+FG^mOa [JgotYtP>wi?@Ƽ8)>oy8>P BXcSa`Lrv~oL]y8^/Ȇp0?ht2 ύ?xj endstream endobj 511 0 obj<>stream HtW;nm7 ŏ:HU< H쿍_??W;+ĕމ@ ?'(?f4Q~??pF@! &,oHHr5?-~r/(kY}D?8?fs@C,X5F?l?D6%H+874dvg2F!?9Qo@Ql|R<KB ?8N GcYC(aAB??z|+b?yF4̻f6SnUW^LH3Xtᄈ>f^'`{ N ?\? ?%Ho??#S"U?X |=Lɑ|ă}aŢ ` ÑA뱡ᆾ"75bG?Kg~}X?e?$|O~wFU?1 ڪZWbuAwX s'?V? WoIm?GcIYwWپTvjh> 6[}s\_.IzrGvr1}[aoKj4 ?` 98?b s\<9I+G|,o\q̧Us? >hB#B ?ݰ !? yt~[9zY 2Lelb=V ? wGi%gDF?{qw[]s}#Ʋ?Xl=k m]?M@?w;-f?1?4Pժ|Iy'K }8T,M,zYj本T}?*µs?YNW#\_SwF?s(]Tߒ;;\g?Waa? v+re2ڵ}]x q[aܾ]_aQ% rӇeV^_&+zgشP@?$Xͷa/v|V @8b<?Ƚ$Lp q &]N.O{?DՅf%ozm`?a2'0]6?OV c 'qg WRwtΦ V$k FbBȭ|S_wbԔ%I?wCK6q?3ڥ'?q@;VK_&?A}ep >=ցG?\h8?UHGK?*Ļ^ BDn棰! dFӵm[?z㉞FX|‰Ӕ?nL%~BBIh.6KD[bUxd V?ߪ2\e8 n.* XSnՠnys M?8Lo:Чd Jݝe]$;>9p5qXcUsSr}r?1UE͑sz?W`e?ÇzSdrKm*_l7 & x3xG [?ƖXn?e\q?~? 0T endstream endobj 512 0 obj<>stream HdUiTW HV-vAW?zaI .EVP4??FM0::E\@F1Ds4z oy̟wwR F(?I?V%XC`|%HBIǼ^gP_]=qR(Z]ezb??αPZf]QO(?_l?}>ZjOCY sVƶ2w?k2>p??f?`?Hf `3Le?51&?3|aIXhwdu:-X ;(Ô=NVǖ?MnW-PUԢ:Q.R7\4.??]c\K\wvv vKv[^P̛qT&?-ZttJ"L`BQ0vN6Wb" ldB0Y[ 'AHS?=hO?j!?B>O?*EBDk`.?Y?zq,q*."h]UH{InP9#gomlVw6]|oTa@ ޮk0kz{-/Qo~=O×iazt}q?V֛¹ssC@ɂ~`Q?pQl ?綅Hc k ݧEf$F&->yeف ^l7p_- uYJ~0(jxXki  &>_(ؔ;gnYjXig{>܌]4?$K<-rx4b  wy̤M`9T?bN ? ׿-\:IBa8Q_ -^9x5ԡlG}cKL$|FKPJ <@nȔ IaTkAg"שvE/!rcA?v٥'O -A苦ߩ xJ;?Lܩ~p?Ag=>xBc?$ KץZ?Z~tުya0Z#C#q rWPGKBQlЬ ˱/I1PGY|`=6,OX'>zwHIvюJܩv??M `TR4Q?gR pqSޔ4ȧ`fia8Ҩ"I?& ,ՠD?ݱ`H\%"zڟ\ܙRL5Ջm9;?WL}u~m&q|E\uE3i^-b;.h/_r}evwNBu?r^^Z?]?5,cV^XF.z?atsEtŌZCN?0 #ePUrQRKUX{& ?e@?d NՏpGR9+Oi--5:l Nţ.7Q,ݎwX.S|f3:/Ωn=E?]Ζq m/ -̛-xh?֧gѓjNm-|Z5{7/U0jt<Z?<{Yib%T )y82%aaKzXo_߱` ~s*GN?^wdkv`*z}ᯗ%rp6?$g?3G?Fǻvq_aN*!-L1/??>zx0U&G W %\ȣY6$@Q ,'?z+WGJ? ;ooԊxr݇[7%`( qy¿ZfC;?EC~٥w[??|pfH?ߺG2@_??Eƹ ?Q7?B?@*a8jU(T>NsU- u:hOm ]liN6>1/)K2uSpG+C{z{k_k#sO??t=?uw??=xvmP?8?թ#CsNښw<i|3r嚩sgOq% J\P0S/ "ktRde6ߖum-Ƥ2M | u ] ?)7lNYC4Aﱓ_d?P]{JyhQH;vF?q5˪Wˈk?ݤFBs]`?8h q R&ZYb>? ?y #ҴԱ? p 15?F 2??C!IAG@,, ? ?s?@rmۋJ eS^bg ̃:qz?0Fݎd ;鄑ҠSL{~+0W8Ep endstream endobj 513 0 obj<>stream HT{Pv{Ѫb?t?oC#?1KpyD`INXGK X@02hU >)?1NMAlD&m=9w5{s{J? H?j¨7?vE|5:aw%B8TرS* 9E挴|]Nv?x?[}W|}t9?]tQ^io?<;%ǜcޕoJy:?d.{Q3e?i&?\wW^JzF?[9? N'rǹsRs Qq .㢔\48ΕՅSq^\dBqO1TU>vXPp7TU O?uFS`|6N?M_ V??\Ox||hx?ڂf?a^~Dk~?N`h?Ȍ7yIWSDy!5D?.D,D^݅??i?w?J|ZmLlZ HOOi'Jdg;[C)cS%Xf?C>/{=)W3I+?הT[j?=\yS3dQku{?Ҁve*W ?f=$?o27>XpGU??.hЌlBb!J©dtkАMfjx^@2P'>_uyp♁wwG5%.l|G+?k^H%u]?0NJNM^"Ee2$? b$ ?ޱ lH?G?!B??9?~TIB-A7oOC\+܇p^e?;hp^bv%E}F'Yn˼][5RXi?7jc^+?%b?n \t{=,91?Y+l}bQRXч}DVj[?bŧή@O eӁ?? s.jYQ }nW:"^\#CubG{J(H8DtHM5S1=w?kZXrAf#!V`v?v{d۲?ٯot|`FV@غ{? 7w:???xLODzǣnSf?PK?}+PCؾX??"*/:K6 ʦX?oAK??S=A:y֥He(B~ݹ| TYӁ4MB學i?DBG\Rf`K:UB7h. YfV?oZ4?ot endstream endobj 514 0 obj<>stream HtTiPTWn^{& 6 B?N?:&E\?e Q'D2?: (Pk v^5sgR̟WswwL򱙳BLUs"ͅcbb)?I+}P?/?@[wJ._ƲRרʾS"Fѡ?|YҼBܲRXi.Lee ]lrBE{{yIlRbfXV-[^XQTdy>`y`Se.r8'Y,W%˔(Y=^a?Z??*U)6(?srSYď$?r'O{:'8sReT_xĸuZzMv w{"wI=]Y}Sqa?95P2 ?0ӫt^CŪl>54XY)A?H aJ?G ¾? :XZOՋM?[[)+s?L+ JZvRO|R4CF\_ U3`j2LBeSPtٹKl? Q%Sq~׵}]49?J?]?@JGw6=ϬT`F mF?~?OuO-zM waD{B $.yuyi~T̻ m"'Hkkw?Hm?i9ɥg7ڑө?͈nA٭bűܚ>ZyAt?(.kU?JQNJzT\y0?( VtCxq?X0 j:'x}2ׄ~>??Ppn8iw?zȁ¦%/oHOGoF^CN(.Ã3V?A:?t>cĤ R~zqWOwvwtp偩єӾZqWOeРI:xA@?q?6:ea\¬[w/}{?u?E??"!(:Zē?%|SPk@?14eZMB-Es0 CH|M$ ?*)A},at?( o[f몢ZOqFlm<% a ?'a1??V4.{g,fz YLjSP?E-v{h&?_Ir7DfN?<,}zT7N桍eyS=sO{j?NFzլΕM ?X#?x_ >i/kX oC? xXLU> yO!u1Pf ?R2ØoL|VS-?HL":iGpHޣzv)|4ܒ:nzr |???D?O?ML2\#to=v-lS4V`æ 2Vs?e?ݶ2Z ? I7P?)4 ;vB 8rAhU k|]~~-TQnFb?Mrƺсlfcb wH1NPj/>Ŏa)kEO'-j?_V%Ѧa? a;Ƴ_Foq6oǦ*VFїE5X.a)Ǚ?"/l=:ޅTƴD VfrVuDl, Hxz\L;,C О c ?p}yE?F? z\lAX~AfC8?`D.^RVcPV!DC#AONE ?O )* XPZ4?pkg\Osfg?3y<_=Vh+JU?Vܟ&* F+5v6z{ߔ_ȅ<Gp!Fˍ?v7yǮD{?>K?p MΉX?jMo<.Ыm)#\gg›Le:iY3q61 DnKӽD ?*6IHէ$J#HyapdHZ\1>7?,%}?{2hlWe]n?A_,THc]Qhh,=]bɥUchVsܶ!5w+v?XPO] _?ڜE]?G?"@?7qmGRb E???fYh;X?i Ĩwe}^~??_?ާ0zmpշDNQzGpZ^JxЌy~ cZhEdJQ ?XJu˓T^bI?hvUطk]Vq[??œ֚?gx{?-| C Gs+9}wW@[h f]?7fK|k+2Os0 ,&tFVߪ2Uv;?gbߟi67nǜSsTZ?JR$%kiqs?`op+?te+ ?Mx ??:) ,?HZjio}_BXnP?TZ_7poቔjG9?S1?+ROB9<` sP` c\rVbsLU#TA:unWqH^g?0?]j??LaNwz)*[?gWp pFv+mg&z=?`|z endstream endobj 515 0 obj<>stream H|U{XWM0DM`D(iBQu}BW Veqm?B~kۭb?ZR=qw'}?oνu?J&? ;sz||bkq3S޴n?4F(U?!?Ӱ ^J*l{|%yQ#Buz}?.?۪ZT?ضؖUj]?dkVZ05dk~0j[`le9EY%9ytq?l/,^YsPJNQ?OS*ԝ2J(MͥZ?IdRT;?pIdddNrH$i?nOe Y,?{_JbCN_7GF?/DO~IA??w{QxS?=+=* ^Cxx{m?Xб?I4Nu߹vK-|{]g7^9FRW.P-&8 $ä\tf@5b#SlcI3(1]a%b?@5$쇘{ejR1chjD{^?b;qP#F#!cўFCLi.aM?ҶmA_?G_?ʳiEo9~>9e(ò&(& ah?ܾbLgk ΅u$(LQ=3U+Xp8+tgW |c g2?P3m"M2 D̀L L-ײ0]=LL'?kB?? #Hm >mUed0tH X˝'O?vk~ֻZ JX Y`A ,[vyjR?5۞j[r?bsh-?c CJS?-L,tM|Q2?JZ~0mf/aq?Pi@ ~> HM,VC  ҴsHfػZ@=|.20? @S{?? ܣ>_}/bLZ"0dX MsZwW(p&C `UG7=}=n??:=<~ JTLi+o,K?aH_ح]~u[N5桊G}PWŬYv:8c`mJXJ?]3[KA?l?En?A!~eNpH>Ԧ?p9nAـVHl^|raVҩrfϰB? {1a|j#wF?rmt]yx'HiM,TlGbUJbNb?OA0?ltaJÓ?ɥi?q?0¯d!d oFe(Éi xɣ d_??p &ED"$ߟOE@ `!@V1?܀Y5WM`jDq?Uůt&;ĿV&U {~/!kx^f=Rs? r1AAK?oV8J!BJCrq>?8DU3NJxN_ .^ kv:(g'A;EB_ |X)L7wbN&BX?\e غ!e^9AfhwmXc╗vpԷ_Q@)l^fO]i?Kaafjutg?{Au`o?W7#BnEՖbE)[ꆕ_Ya?z;5O?B@~jLyiZ 2|/,g oi`?ڮES=}] J> ApDt?BD.}i͂qH??U~лٽz\MC\ zp?j$ܝfAs0H5z-QIZ}O\[mg}P(5 >Jb`ưt*K݃e2lJ%>Ԥ)3L|?kd I֮O{UX*=R'}H?o8zN Woٳ\w4_[eV}]yHT?vEAbdկEr1j5VvG@.DFa M~ j?*aId|'xx? u1y?C\df1W f(WGڭ uRq~i!V¤A?Q7c ?`0jQ;j\ۣI(,p\,d|D8?W0ΜO@̻?U&zu?tgr-ƺÇl?sGD5rۛ?h?swϷB ׆ 9?l|ъvscC17pᬫIre'0T&t"wR{0?ӫvAw =&L: ]0gRE|C?ךٯ\/Ylb+ 2X?fՓES͊N)gLtZSRIc_E|I" ]~ک!.3?@w+?w'F?nB DBd N>t??? }av?Hכɻ? n%HG_Xa?S2<@Xia# V.Ts6-? F_M^/ޱRުXsh‚ ̳0kВT#sy5+vk8}oc<6©h,clz^RJJ*Kg40N&\D?qj i;~?3Vwo??Rdʵr ُuJdD?Ar?pdŔjb8ǛiRz>p? yxKAx^%DY endstream endobj 516 0 obj<>stream Hbd`ab`dduvqtvL)1N?IM35IHf??_հ~w??#cLs~AeQfzFF? L?8'?W+x?%)8(?V(J-N-* <.f`bXGjQnlmj7W?٘fr⤀2稂F?\^lޞi;g=Yœfg,.[ye n{L?,'pi㔊y˛wg~QwwQU%MU=uK/n\ݶpI?m9ViYBl'Er!I?/@ݬX}C?ݧMHַse[m͞V7rAعsf⨈JvJSnE?w-}|?.?=?Xγae?e+Wmo<\5?ƙkRwI_7}?]kg.?cRvWѺ™ [w/ݿ|k9Zr gsj^Tꇈs p endstream endobj 517 0 obj<>stream H\@@?9?OWs,]՚Vӡ?L4B0URQ5 !rĺ eۆM[һr[vi JGLGc2?ʹhM\?^oMoqF?e3?ٜDN}xcѓWGO^P\Y5 w0}u?Q+\?+Ɇ?9nrvܲpٓ|`pW=^B~;R|?\<h.N8_%| 0RSD endstream endobj 518 0 obj<> endobj 519 0 obj<>stream HUkXT>} -.gR% E]?(?E? W.rU HwZ"" #iy4 ?z?sf杙wfO˜?djŋ#?ڄn?{zyUN"LEkLy~?uto'3&ɑyUG#nM&dlЫsU! C\UҦtFlN7N@?XO۠7$ *Mq?t?u ??0eI 3لq? 0jdY?&X?5e&V"1??iU +KJL&dJRi1 3m &$đzNҕ0})?*VLzfDV4u?Fx틱Of&r|?ݵ&79vOQi03C?"b{g$0¬"]ɗ {;ft?3LsC9zJ`X́{]̋_RcRg{桙odgl;s:B?в] z;pQpzRY!l{ ??#o{뾱)oϦ嶂Bupb0?B6Zw? H%wN,ҷyZ1湳I?G?0ASɂ3~.X?r?_њ,CZ?0mO?^k 3$ FcMaOk ~E{Q?Bڼe?û-խ5ĤԒ$EL `/:N炃@?'k_'??ii}F {؁; B Xuo>yS)tX BA?XCߵ>hP|ásLT?¼t?{YvW?[| ?Z)?*kF #96r)MuhIqmlR?8S ` t[(Z4Z?(7D~pZR)VZ?oYa2?^ô2 5Bd8B>d<٤wDe=?GW&lP??K͐q\SnOWC_іuko?pCsRpv.oom]]F} e?۫+J?E)?//auh?f]0 Ra&H@b4i(- 1$OvEM??\qXZPtJ? f`.uBO@w^0,_w%G??_p[sβ[x(ԱJo?Έlr} mMͶE$yY˜??zJx1eT:qx|o˫hiw@]8[{Ֆimm:b]~aq~q>h?孍]KBc41|G(4~MbPyA.a\~ayn~)nl,=y _wكA"4??F{r|Z{RsӴ?qғv&hpnG:_q=G2Þc'*?2kv@DBQ'?q|iű'D$?#?$EAYZQ?H v&=3@4Gg>` 暤w2?XyљA^`({?\3x/༫~xl$7GHq^YVwu_QSH?kcq[ Qh@&T@?(7:X4k5dcaVQ WXPUU?K?<.nFcB{FxKn endstream endobj 520 0 obj<> endobj 521 0 obj<>stream Hbd`ab`dduvpvL)1LIML211?2Jf??ꯚI[wv_/8}s~AeQfzFJCK  ii&u SR?KRs< KRSsr@RS@` =R3SRsRS\Js32R?AL(?@r2Eߙ~drk?H+nekHhH0lY^ endstream endobj 522 0 obj<> endobj 523 0 obj<>stream Hbd`ab`dduvqvvL)1LIML211NKJe??6Dž'?VҼL7'#e_PYQRBHZIc##ǔTbϼĒ=ǜ bԢ2??Cv̔ԜԢ?̼Gw= E`&`o ̌L ~x~c*۬ˬ_xLzƌN,+??Mv`5bc}ʦ?ɬ$b? dTc Pj Kw=b endstream endobj 524 0 obj<> endobj 525 0 obj<>stream HTo w~ǫ:ҩRЫN58)RcC] r`Xc)AZQ㋉fFV_탃%lhByЀD{%.6,寴^Q:nbʜuݫ"C,s  j endstream endobj 526 0 obj<>stream Hώ0> endobj 528 0 obj<>stream application/postscript Adobe Illustrator CS3 2018-09-24T14:18:04+08:00 2018-09-24T14:18:04+08:00 2018-09-24T14:18:04+08:00 256 28 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAHAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A6n5287+YdW8xHyh5SJSZ WMd3eIaNyX7YV/8Adap+03Wu3zKtQ/kNBNCZNS1maW/cVeREBXl3+2SzfOoxtUskvfOn5ZapAl7c Pqvl2duK1JIoOoXkWMUgG/GvE/qUPTNb0jT/ADf5diiS6kis7r07iK4gIDFacl6g+O+BLxvyd5IX zB5i1jS5NSuIItNZxHIp5MwWUxjlUgdBkkJ35m/L3XvJ+nPr2ha5cP8AVCrTxGqtwJA5bMVcAndW XpgtWYWUcP5i+RLF7ueS0lZw1w1uQG9WHkjdQdmrypil5p5F8kL5l1XVrObUri3TTmAjZDyLAuy7 1P8Ak4UJn5v/ACl1fS7e3fQ7i81WWRys0ew4KBUHY9zgtXoH5k+U7fXNKN5LdT276VBczRLCQA5K BqPUH/feIS8q/K7zxcaDq6w6hIx0fUX9KWRySscq0pICfDkA/sa9sSh7R5t8rWvmfTIrGe5lto45 lnWW3IDEqjLTcHb48CXkf5V+U4te1S+nub25jOjz27wqjCj1eQ0fkD/vodMJQ94wJdirxn83r7Ud Z81Wvl3SyzSWNvJPKiEishjMrA08I4xT3OEIZh+UOvnVvJ0EUr8rnTmNrKSakqu8Z/4AhfoxKWUa 5rFno2k3Op3hpb2qF2A6seiqPdmIAwK8k02x86/mZNLe3l82meX1cpHDHXg1OqqgK8yO7Mfl4YUJ pcfkTbwRerpGs3FvfIKo8gHEkbgVj4Mu/ffG0o/8mvNGtavZ6lY6rObmTTXiEVw55SES8wVZurUM exO++JVL/OPnPzHrvmVvKPlFzE0ZZLy9Q8W5J/eUkG6InQkbk7D3VXRfkNZSxc9Q1i4nvXFXlRVC 8v8AZ82b78bVLdOTzP5H8/aZoJ1R7/S9RaMCOTlx4SOUrwYtwdWX9k7/AIYoTz85fLEM2k3HmYXc 8dzYwwwR26MBEwa4pVtq1/fHviEsf8l/lZD5g8tWerzavcwSXPqcokoVHpyvHsSf8jG0Jj5W8i63 5f8AzIh4fWbrRoY3/wBOk2Qs8J2IB7MaYqs/MjVtb1nzrZ+TNPu2sraQILhlJHNpF5ktShKqnRa7 nEKpaz+SY0vSZ9R0jVLhtQs4mmVOFDIUHIqnpnkrEDbrvjasw8i61rQ8htf64krXlks7P6ylJXSE Fl5cgCTTauKXnnlXyzqn5k3F7q2uapKlvDKESGPejEcuKKx4oqqfDfFCIu/KvmXyJ5m0xtBurq9s Lpx68axuUCh1DrMF5IahtjtiqK/IWOO4v9dv5jzvaQryP2qStIzn/ZMgxKvYsCWIfm1bW0/kLUmn ArB6UsLH9mQSqop8wxX6cIVR/J2eaXyFZCXcRPNHGSa1QSEj7iSMSrzzyj5y0jyv5y8xXGpLK0dx NLHH6KhjUTsd6suKE187fmvY+YNHk0LQLO5mudQKxuzoK8eQPGNELlmalMaVn/5eeXp9A8p2Vhci l2Q01yvXi8h5cf8AYigwFLyPyXr/AJk0jXtdbRNJbVXmlInVQ54BZH4n4PGpySHpnlDzZ5z1XVja 6xoD6ZaCJnFyyyAcwRRfiFN6nAlkXmf/AJRvVv8AmDuP+TTYFeOeQ/J0Pmj8v9UtRRb+C8MtjMe0 npJVSf5XGx+/thQy38ovOE91byeWNWrHqumApEJNmeKM8Shr+1Edvl8jiUpZ+Q/+9fmX/jJbf8Sn xKvW8Cqd1cw2ttLcztwhgRpJXPQKg5MfuGKvFfy38yaCfNGteZtevorS5uWK2schNQJW5NSgOyqq qMKFb8ttX03SvzH1PSbC4SbSNTLfU3Q/DyWssQ38EZk+eJVkf57TSJ5Nt1RiFlvokkHioilan/BK DiEsq8j29vB5O0WOAD0zZwPttVpEDufpZicCp3iqkYkgikaCJQ/EkKoA5EA0BpiryT8g0jmuddvZ TzvD6Clz9rjIZGY1/wAplH3YSr2DAqxoYWcOyKzr9liASPkcVYl+bv8A5LzVv+jf/qJixCsD8kec fPWneWLKz0vy29/Yxer6N2FlIflK7NuopsxIwoen+TdZ13VtMluda006XdJO0aW7BgWjCKQ/x77l iPowJY3+Y35c32t30GuaJcC31i2VRxLFA/pnkjK4+y499unTCFSK2/NLzn5bmSz846S8iV4i7RRG 7eJBFYZP9jTGkPTtL1TStf0hLuzcXFjdoymoI2NVdGHUEdDgS8sl8k+fvJOoz3vlOT6/pspq9qaM 5UbgSRHjyIrQNHv8sKE+8p/nDZ6jfJpWuWjaZqTuIlbf0mkO3Fg3xxknoDX540li959e/LTz7LqA geXy/qRb7A29N25lBWi+pE3QHqPnih6bafmD5KurUXKazaohFSk0qxSDatPTcq/4YEvOPzB86N5x ubfyr5XR7qKSUNPOAVWRl+yBXpGh+Jmb9Q3KHpuj2ml+VPLVlY3N1Fb21ogje4mdYkaRyWc1YgfE 5JAwJeWflvfeXV85+YpdTuLMW80khtXuXi4OWnJHplzQ1HhhKHs1vYWNsxa3tooWOxMaKhP3AYEt X2o6fp8Pr391DaQFgolnkWJOR6Dk5Artirx/8o9a0aw1/wAxS31/b2sU7qYXnlSNX/eSH4SxAbY9 sJQzXzf+Zui6NpS3emXVnqtyZVjNrFcxlgrAkv8AAXO1PDGkph5k13TY/KU8l7dQWk2oWErW8Msq IXZoalYwxBYguBtgVhP5FappkGkXllPeQRXk93WC2eRFlf8AdqPgQnk3TsMJVU/NfyzeadfQedtD Hp3do6m+CDw2WUgdR+y/t9OIVDfkDIZJfMUhFC7WrEfMznEq9ewK88/OLzZZWXlq50m2uo21K7dI JrdHUyxxMPUYugPJQygDfrywhVvkLyH5Ju/KtjLNb2up3hSt5OjiTjK/7wxMUagZFcCmKsW/NLSd D8satpGpeX/q9reWsgaeyjceoCpEkUjR1LcTRgTSnTEIZ/5ht9K8+eTZ7fTLqKaZkjng4urGKYDm qScSeBIJU16YpYj+W/5i22jW3+GPM3KxnsnMdvPKpAVSa+nL3UqTselPCm6UPQLzz55NtLczy6za MlOQWKVJXI9kjLMfuwJY1+V/nLXPMuoay94/PToGX6l+7VOIdnIUso3PEDCVYpOb78s/Pk14YGl8 v6mWpw6emzcuIJ29SI9j1HzxQ9PsvPvk28thcRazaKlKlZpUicV/mSQqw+7AlhXmD8z7q584aTpX la8FxaSyxxXpSJXVi8gBCMwrsnUjbDSp1+cGp6bH5K1LT5LuFL+ZYHitGkUTOouU+JYyeRHwncDs cQqG/K7zN5bsvImmW15qtnbXMfr+pBNcRRuvK4kYVVmBFQa4lUY/5lWsnnex8vaesF9aXagtfwTi QK3F2K0QMtRwHfvjSpTc/mLfaP8AmVdaTrdwINC4gW5Ma0UvGrIxdRyK1qPbv0xVM/PnnLyRL5Vv 7eW/tdQe4hdLe2gkSZzKV/dtRCeHFqHkemKpD+Wi63pv5W6vf2wZZ2a4udOUryr6cSryCmtash29 sVTb8vvzO0zUtGC69qkEGrRu4l9cpbqyE1QqTxQ7beONKw782tU0XzBr+lWvl5kvNUBaKW5t9wxd lESB1+1xNTUdMQh7Hrv6E/Rc36b9D9G0/ffWePp+32u/h38MCXk1x/yoH124+rSu/p/XOH0ct8KG feRP+Vf/AFaT/CfodP3/AB5fWKf5fq/vaV8dsCUZ52/wr+g2/wAUf8cr1E5f3395+x/cfHirAIf+ hffWT0/7zkOH/HS+1XbrhV67gVj3nn/CP6FX/FX/ABzPWTj/AH397RuP9x8fSvtirAP+sef8/wBJ YVd/1jz/AJ/pLFWVedf+VZ/U9I/xP/vN6b/or/er+74x8v7jfpw+3/XFUn8uf8qS/Tll+hf+Or6g +p/73/3nb+8+D/gsVekXv1T6nP8AXOP1T03+sep9j0+J58q9uPXArFfy+/5V5XUP8H/8VfXv96f8 v0v96P8AZ/Z+ntirMMVeb+bv+VN/4hu/8Rf8dn939a/3u/30vD+5/d/3fHp+vCrJPIX+Df0PN/hL /jnfWG9X+/8A7/gnL/ej4/scem2BUh86/wDKo/06/wDif/jq+mnP/e37FPg/uPg6YVTjyB/gT6pd /wCEP95/UX61/vR9vj8P+9G/TwwKhfPv/Ks+Sf4q9D61T93x5/WePb+4/ecfDlthVhdt/wAqB9Ve Xq07er9c4/TxxQ9V8uf4e/RUX+H/AEP0bU8Pq3Hhy71p+1413wJVNd/Qf6Mm/Tnofo6n7361x9P2 +138Kb+GKvJbj/lQXrNx9alf91/XOH0ct8KGZ+RP+VX+q3+Fvq/1yhrz9T6zx78fX/ecfHjtilR8 +/8AKq/0xD/i3/jo/V19L/ez+45vx/3n+D7fLrvirG/+sef8/wBJYqmvlb/lS36fs/0D/wAdfkfq n+9/2uJr/e/B9mvXFU98/f8AKu/Sh/xZ6PqU/wBH/vPrHGv7Po/vONfoxVhGnf8AKhPrcf2+VRx+ sfWvTr/lfs0/1tsUPYLX6r9Wi+qcPqvBfQ9Knp8KfDw47cadKYEvLPMn/Kjf0lL9b4/XOR9b6l6/ Dl3/ALr91WvWmFCc+Qf+VU/Xj/hr0/0nxNPX9X1+Pf0/X9uvDFL/AP/Z uuid:A7354AFB96C1E81186C0E1ACBCA73DB7 uuid:A8354AFB96C1E81186C0E1ACBCA73DB7 uuid:fe3e98a7-5223-e141-97d2-3629640fb861 uuid:46322547-5fae-1945-9ee0-dc108487ccca 595.276001 779.528015 Points 1 False False Black Default Swatch Group 0 endstream endobj 529 0 obj<> endobj 530 0 obj<>stream Hn?i1*9ﺎu'̅-O?9ϓX?E?ձ6l4Ĥ3\xf?G?bv-@?97r/]Vг\j?WׯI?G zJr`bÊd?cZ?> endobj 532 0 obj<>stream application/postscript LOGO_journals 2014-12-02T11:35:18+01:00 2014-12-02T11:35:18+01:00 2014-12-02T11:35:18+01:00 Adobe Illustrator CC 2014 (Macintosh) 256 76 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgATAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A775889WHluOC1luI7a8v lc28szKiBUoGNW2qOQpXDGUb9RTLS6rJjJwQM651vXw5vPINepFJf2+ofut3kuopaivUsXU5l8cC OY2eXzYNRgl64zhLzBH3pr+WX5l3Os+Y7+yvrzjpsFqZbd7gqpLLIqlizeIfYVzXSzxMu6Ls+y8m TLIw3kaegXPnPyxbV56hGxHaKsv/ABANlUtZiH8T0UOzNRLlA/Hb70dpOr2Oq2gu7J+cPIoaihBX sQctxZo5BcWjUaeeGXDPmjMtaHYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FX Yq7FXYq7FXYq7FXh3/OUtkH0jQb6m8NxPBX/AIzIrf8AMnKcvMPZ+x2SsmSPeAfl/a8A0yX072Nq VLckAG+7qU/42ymY2ej9o8Pidn5o/wC1k/6X1foZf5V1C3t9ehgkcCS5R40HvTkK/PjQZj6nTyli MgNovkfslGQ1XF/DwkPQM0r6azX8stY9DUZdNkakd2OcQP8Av1Bv/wAEv6s2fZuapGJ6ui7c03FA ZBzj9z0zN28q7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXY qxbzD5j8lT27Wuoxw6tGDX6sYkuErSlfjHp/jmBm1+GPXi9y49WcRuEjE+Rp5frXl7yFqd0n1Hy7 Dp0nMcLiKSVGG/URoyxfepzV5u0jR4Y07CHtDq5DwzPihP0m6Ox2Pm8E1CDUtK1+WGRiL+yuKB6f txt8LAeBoCM7bTSx5sETEeicfvWMBp9htwPVz5pt/SjKwOZSAZEJCgHuAw5V+7NVD2VmT6pgD3X+ p12f/gjYR/d4pS95Ef8Aik78h32paz5vsLazjEEaOJ55CSzJHF8TEEcRv9kbd8yJ+z+HBDjMpGQ5 chv9v3uDh9tNVrcvhRxwjCXPnI177A+zm9q83+YB5f8ALt5q3piV7dQIoiaBndgig+1WqfbKXPeb +S/PH5keYtagdUR9IjnjW/MUSKiIx3AZqv08CThQ9gwJdirsVdirsVdirzSH82dQk87ny6bCIQi/ ey9fm3Lispj5U6V2xVE/mFrH5jWWtQxeWbaSawa2VpWS3WYesZHDDkQf2Qu2Ks50t7qTTLSS7BW7 eGNrhSOJEhQFxTt8WKonFXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYq8HzinXKtr/vTD/rr+ vBPkW3B9cfeGLeePId3qPmi11exg9UPGfrSggfvIqCNiWI6qf+FzdeyvbeHDiOPPLhEDcfj0289/ i7r2l0ufJhMcEeKc/SeWw68/LZNdG/J3zbqlutwDbW0LGlZpCTsaHaNXzt8Pbmnyw48ZMo+6vvp8 5Psvq4mp8MT5n9VvUvy6/LlfKZurie4S7vboKgkRCoSNTUqKkk8jQn5DMLWazxqAFAO/7K7JGlsk 8UpfYEk/O3QLufTv02t6UtrRI4ZLGjUkZ5dmJ5U25eGYLuWH/lt5X1DULW71e31FrWHTn5S2qhqS 0jLdQyj8MKEl8szec9W1B9M0i8uGnu4zHKTMwCxBlZiWJ+EfCK0+XfFU+1i980eRNFby2bpEvtQk a7lureRmZYCAihGYKVLujVPt74qoT/lv5mtPLC+axej1/TW6eFWcTLEwBD+p/MAakdvHFVa68+6t q35ezWt1cv8ApKwu4ALpWKvJDIslORWlSpWhPfbviqh5Z8r+dfOWizLDqNNNtJWCxXEr8ZJioYjY NWg47t0rt3xVD/l/PrV3qM/lWG+ktYdUjkj6llikhHrc1AK0NIyux74qlcOhXT+dToYvCt0L97T6 9Q15rKU9Sla7kV64qnn5i22seXL3StJOpzTvDYcpJ1d05l7q4epHI9AQvXtiqYee/PervDpvl3T7 preJLO1+vTh+DSSyxI3FpNqKFYV38a4qlGteWofLtlBq2k+abW81BWX6xFZzqJVZt+UZSRmdQeuw 8cVTPzR511HWvIWk3bTvFfwXclteSRMY+ZWMMrfDTqrCvvXFUHoXlb8wPN2kxTQ3Z/R9oWjtjczO oZuRduIAYkhm+0flXbFVDzvrWqX/AJvn0zWL2W0022nFt6a8nSOFDx9QRAjmWX4/E4qmGkeXdRst ahk8l+ZLW8B4ukbzC3dzXeN7djVxtvir3pCxRSw4sQOQ60OBLeKuxV2KuxV2KuxV2KuxV2KuxV81 ar538r6ZVbm/jaUf7phPqvXwIStPppnOafsnU5eUSB3nb7/0OqlmiOrD9R/OkRyA6Rp9WUgrLdHa o8Y4z/xvm7wezAI/ez+Ef1n9TUNWQQQOTPPJP5naL5lVbaQix1am9pIw4yHuYWNOX+r1/XnIdsez ebSXOPrxd/Uf1h+nl7uT23Z3bOPUek+nJ3d/u/FvcfKX/HDh/wBZ/wDiRzfdgf4rH3n73C7S/vj8 E4zcuAwv84f+UCvv+MkH/J5cVYt+TX/KI+Yfm3/Jk4UJN+RH/KX3f/bPk/5PQ4Epr+e3l+8e5ste iQyWyQi1uSor6ZDs6FvZvUIriqE1H83LC68hnRhbS/paW2W0lchfRoFCNIGry+Jeg49cKGLReX7y 2/L+71m4Qxx3l3bxWoYU5IiyFn+RJAHyOKvTvyI/5RG8/wC2hJ/yZhwJef8A5Y/+TOsf+Ml3/wAm JcKENqt5+g/zQu766jZktdUkuXjX7RjaUyCladVbFUR+auvWev6tperWaSR21zp44JMFDj07q4jN QpcdU8cUqHnzQ7jT7/TdTliMun6haWkiNuFLJAiSRFh0Pw1+RxQmOo6l+T8NjFNYaPdXd29Odq88 sIQd+UlZAf8AYg4qp+a7Oxj8iaXeWelPpEV9eSSJbyTvcF0EQVZKuqFeXYU6b98Vep/lJ/5L3Sv+ jj/qJkwJYH5080aPJ5sm0/zR5diMcEvptfRPIlwYK/u5BxKcvhoaE4UMK8yw+XF1mJfKctzPbsFK +qCHExY0WPZWPam1a4q+ldHF6NIsRfmt8LeIXR8ZeA5/8NXAlF4q7FXYq7FXYq7FXYq7FXYq7FXi v5pf844aPr3rar5W9PS9YNXks6cbSdu9AP7pz4qOJ7j9rM7BrTHaW4cHPohLeOxeA2v5RfmXdarL pcPl28+tQuY5WeP04VYb/wB+5WGhG4PPftmxOogBdh1w0+QmqL0ryv8A84peY5zHP5g1aHTV2Y29 qDcTCh6FzwjU+4LZi5NfHoLcrHoJcyafRflrQk0LRbbSku7i+W2BH1q7ZXmepJ+NlVAevh881Ecc I7QAiO4cnbcUj9RMj3nmmeSQo3ljZX1u1te28d1btQtDMiyISDUVVgRscVUrLR9IsYZIbKxt7WGb +9ihiSNX2p8SqADt44qssNA0LTpjNp+nWtnMylGlghjiYqSCVLIoNKgbYqjJI45Y2jkUPG4IdGAI IPUEHFUjXyF5MWf1xo1pzBqP3S8a/wCp9n8MVTW80zTr63Fte2sN1bqQVhmjWRAVFAQrAjbFXWGm 6dp0Jh0+1hs4WYu0UEaxKWIALFUAFaAb4qh7Xy55etLpbu10u0t7pSStxFBEkgLAhqOqhtwSDirt S8uaBqcgl1DTra6lUUEksSO9PDkRWmKqbeUvKzRxRvo9k6QL6cKvbxNwXkX4rVTQcmJ+ZOKo2fTt PuLP6lPbRS2fEILZ0Vo+KigHAilB2xVKrbyJ5OtpxPDo9qsqmqsYw1D4gNUYqmd/pOl6iiR6hZwX kcZrGlxGkoU9KgODTFVS0s7Oyt0trOCO2to68IYUWNFqSxoqgAVJriqG1XQNE1ZVXU7GG74fYaVA zLX+Vuo+jFUPpvlHyxpk4nsNMt4Jx9mZYxzHyY1I+jFU3xV2KuxV2KuxV2KuxV2KuxV2KuxV2Kux V2KuxV2KoPVtWstKszd3jMsAYKSiM5q3TZQTiqSeXbzyzpHlP65p8sz6Qjs3qOrNJyaQIfhChvte 2KqzefvKwsI70XZeOZ2jiiVHMrOvUCOnLavXpiqK0PzXo2tTTQWcjC5gFZbeVGjkC9K0btiqb4q8 7n8o+XD+YUenmyX6nJppuXh5PQymZl5V5V6YoZU3nDy+mrNpUtwYrxOVRIjqnwLzb94Rx2UV64pQ sX5heWJLqOATyKsz+nDcvE6ws3TZyPHviq/UvPfl3T7mW3llklkt9rgwRvIsZ8HYDiDiqYS+YNKT RhrIm9TTyqsJY1ZyQzBB8IHL7RodtsVS8effK5sEvUujIkkjQxxJG5laRQCVEdOWwYGvTFVS087+ W7mzurv616MdkQLpZlaN0LVC/CRU1ptTFVumeefL+oX0djFJJFczDlAs8bxCQf5BYUOKq1n5v0O7 1Y6TDK5vgXX02jdRWOvKjEAdsVXa55q0bRHjTUZHjMillKxu4oDTcqDTFXa15q0XRlhbUJXjW4Ut Gyxu4oKdeINPtd8VQ1/588t2cohM73EvASslvG8vFGHIFiBQbHFUz0jWdO1eyW90+UTQMStaEEMO qsDuDiqV3vn3y5a3Ulqssl1ND/fC2jaYIR2ZlFMVREF35b816W6Iy3tmWAmiPJGVlPIBl+FhuMVS r8s444dDvI0AWOO/uFUdgq8QOuKhEz/mH5ZimkjjlluVh2lmt4nkjX/ZgU+7FU60vVtO1W0W70+d bi3bbmtdj4MDQg+xxVJ7vz/5ctrqa2Ektw9uaTtbxPKiEdQWUU2xVcnn/wAqy3EVvBdmeSVQy+nH IwAb+Yhdj4g4qu0vzz5d1S/Sws5pHuXrRWikUDipY1LKANlPXFWtS89eXNOv3sLqaRbmM0ZFhkbs G2KqQdj2xVkGKuxV2KuxV2KuxVif5W/8oXZ/683/ACdbFUF+Wmk2o/Smquga7e9mhjc7lI1NSF8O RbfFARmoIsX5laTKgAe4spo5SO4SrCuKWW4qxOX/AMmlD/2xz/1ENiqE8+6bDqXmXytZT7wyy3Pq r/MqiJmX/ZBaYqmP5iW0B8k36cFCRJGYlAoF4yKBxp022xVMvLemWljoNpaxICjQq0xIqZHdauz1 6licVSf8sRx8rhB9lLmdUHgA/QYqEJ+XWl2ovNe1MoDcnUZ7dGI+yiEMePhyL7/LFCy60izvfzUX 1o1ZIbFbtkP2XkR/TRmHcryFPliqM/MNFX9AXIFJ49Wt1R+4DciR9JQYpXat/wCTF0P/AJhbn/iJ xVX/ADIlSPyXqJY/bWNFHiWlUYqv84/8oPf/APMKP4Yqr+TNKtNN8uWKQIA80KTTyU+J5JFDMzHq eu3tirE4bibT9I88NZVjaK7k9IJtw5/CzLTpQGuFDL/KOnWFh5dsY7JV9OSGOVpFG8jOoYuT3rXA lJbuCGw/MrTWsqRnVLecahEuwb01LJIQO5ZaVxVjzXU9v+XWs+ixj9bU5YZZBX4Y3kUP08Rt9OFD 0nS9PstPsIbSyRUtolAQLTfb7RI6k9ScCWD34/Q/mrXotKPpJcaNNeyxR9EuEqFYAdD3/wBlhQyL yDa2lv5S076soAliEsrDq0jbsSe5rtgSl3li1tbbz15nitlCx0tnKqKANIhd/wDhiTiq6+H6G8+2 t6Phs9ej+q3B7C5j/uifdhRR9OKrtIH6Y87ajqp+K10hf0fZnt6p3nYe4rx+RxVluKuxV2KuxV2K oTVF1RrJxpbwx3lRwa4DNHSvxVC79MVY15c8vecNE0eTTobqxYRitmzLKaO0gZ/U6VHEtSnfFUR5 P0DzHozzQ3lxay2UzyTssSv6nqyEd2oOO2Kr/MOg65c67Y6tpM9vFLZxSRcbkOwPqbHZPb3xVkuK sKl8u+eW18a0t3p4uVgNqilJePpcy+4/mqfHFCtrnl7zdfa7a6lbXNkkenPI1ikiycqSqFb1Kdfs 9sUpv5g0i91by1PppkjS8uI0V5NxHzBVmI6mm22Kq2gW+sW2niDVZIJZ4yFia3DKvpKqha8t+VQc VSPy/wCX/N2jWVzZw3Nk0Tc5LUsshIleRW+Pp8PHl074qqeUvL/mXR7i5W7uLSWzu5pbqZYlk9T1 pQB8Jag4/DiqpqGga9/ixdb02e2RGtltJo5w5bgJObceO1dhTfFUR5w0K/1iys47GWKK4tLuO7Vp uRQ+krAD4QT1YYqg9X8ueYbz9F6nBdW8XmDTuYZ+L/V5Fk2K/tMPh9sVQWr+T/NHmG0lXW7+3R0U mztLRZBAJf8AfkjP8Z2qKdsVRWp6J5zv9AGmSXVjzlDx3UnCUAx0X0+Hg2zctvDFU48t2es2enJa 6pLBK8IWOBrcMB6aKFHLl+1tiqVaf5Y1i21jU2mktZtE1WaWS6t2DmYq6MoUHZe4riqjaaB500SM 2eiX1pdaaCfq8eoLJ6kQJrxDRfaHz+7FUw0Dyxc2moTaxq119e1i4X0zIF4xxR1r6cS+Hv8A21VQ mmeT7q3XU9MvJobnQL9pZUi4ss6ySspHxfZovHr474qp2uj+f9LhFjp9/Y3djGOFvLepKJkQdF/d 1VuI8cVTHy75XGnG7ur+4OoapqH+9ly6gAqBQRqvZRiqW23lTzLpPqW2g6tHFpjuzR29zF6jQ8iS Qjd9/H/bVQvkOzNt5o8xoLlr4IbdZbxqfHMVZpemwo9RTtihMvzJW2HlWeaV/TngkjlsnG7eurDi FHiRXFKYeUdHbSfL9raSf70lfVumPUzSfE9flWn0YqnGKuxV2KuxV2KuxV2KuxV2KuxV2KuxV2Ku xV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV5jc/wCEvrU/1T9PfVvUk+sfU/V+r8qnny5/F164 UM08o/4b/Q6f4f4/U+R50rz9Sg5epy+Ll8/1YEsVh/wb/iRPrn6S5fWn+q/XuX1L6zzNfTr35fzb YUPRMCX/2Q== xmp.iid:07d0e97b-c01d-4a20-9892-fadb500e854b xmp.did:07d0e97b-c01d-4a20-9892-fadb500e854b uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:982aef0b-10fd-8e4b-b72c-e2337f4cb029 xmp.did:3fe272f3-c268-46ee-a2e2-08382aa440b3 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:3fe272f3-c268-46ee-a2e2-08382aa440b3 2014-10-14T14:13:53+02:00 Adobe Illustrator CC 2014 (Macintosh) / saved xmp.iid:07d0e97b-c01d-4a20-9892-fadb500e854b 2014-12-02T11:35:18+01:00 Adobe Illustrator CC 2014 (Macintosh) / Print False False 1 159.998833 49.999194 Millimeters Cyan Magenta Yellow Black Groupe de nuances par défaut 0 Blanc CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Noir CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 Rouge CMJN CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 Jaune CMJN CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 Vert CMJN CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 Cyan CMJN CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 Bleu CMJN CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 Magenta CMJN CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 J=90 N=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 J=85 N=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 J=95 N=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 J=100 N=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 J=85 N=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 J=90 N=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 J=100 N=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 J=100 N=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 J=100 N=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 J=100 N=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 J=95 N=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 J=75 N=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 J=45 N=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 J=0 N=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 J=0 N=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 J=5 N=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 J=25 N=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 J=0 N=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 J=0 N=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 J=35 N=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 J=50 N=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 J=20 N=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 J=40 N=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 J=50 N=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 J=60 N=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 J=65 N=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 J=65 N=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 J=75 N=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 J=80 N=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 J=90 N=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 J=100 N=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 J=80 N=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 Gris 1 C=0 M=0 J=0 N=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 J=0 N=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 J=0 N=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 J=0 N=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 J=0 N=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 J=0 N=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 J=0 N=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 J=0 N=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 J=0 N=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 J=0 N=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 J=0 N=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Couleurs vives 1 C=0 M=100 J=100 N=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 J=100 N=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 J=95 N=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 J=100 N=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 J=0 N=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 J=0 N=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 11.00 endstream endobj 533 0 obj<> endobj 534 0 obj<>stream HMn?=?i9H A?IxKcEԸR|?z^d;?? Gbf$KXk[RUAO瓹mv{}'=/g]mB?QǜUA?F2eYU5?T$eg4 j\}bUDs޶-kO kfY?S>?ё4E?š6lĤ^M~42hYb?X?/"?rf}NbLH/t?YA/zn̦|!|8~Jr0P&I?*1H9Po(??vQ -jh`0Ir#캠]`%6in |>t?o-aAcqpqC endstream endobj 535 0 obj<> endobj 536 0 obj<>stream application/postscript Print 2018-04-03T19:09:44+08:00 2018-04-03T19:09:44+08:00 2018-04-03T19:09:44+08:00 Adobe Illustrator CS6 (Windows) 256 256 JPEG /9j/4AAQSkZJRgABAgEASABIAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABAASAAAAAEA AQBIAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgBAAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A7ZoWhQ+cI5Ne115bi2nl kWwsBI6QxwoxQGilTyquKpt/yrLyR/1bf+S9x/1UxV3/ACrLyR/1bf8Akvcf9VMVd/yrLyR/1bf+ S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLyR/1bf+S9x/1UxV3/ACrLyR/1bf8Akvcf9VMVd/yr LyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLyR/1bf+S9x/1UxV3/ACrLyR/1bf8Akvcf 9VMVd/yrLyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLyR/1bf+S9x/1UxV3/ACrLyR/1 bf8Akvcf9VMVd/yrLyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLyR/1bf+S9x/1UxV3/ ACrLyR/1bf8Akvcf9VMVd/yrLyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLyR/1bf+S9 x/1UxV3/ACrLyR/1bf8Akvcf9VMVd/yrLyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBVMVd/yrLy R/1bf+S9x/1UxV3/ACrLyR/1bf8Akvcf9VMVd/yrLyR/1bf+S9x/1UxV3/KsvJH/AFbf+S9x/wBV MVd/yrLyR/1bf+S9x/1UxV3/ACrLyR/1bf8Akvcf9VMVSrXdCg8nwpr2gvJb29vLGL+wMjPDJC7B Ds5Y8qt1xVNfyy/5QjTf+e//AFESYqyfFXYq7FXYq7FXYq7FXYq7FXYq7FXYqtkkjjRpJGCIoqzs QAAO5JxVjWpfmf8Al/prFLrXrTmOqwv65G9KEQiSh9sVSOf8/Py0jZgl/NMF6MlvMA21duaofvxp bdB+fn5aSMoe/mhDdWe3mIXau/BXP3Y0tp3pn5n/AJfak/C11205nosz+gT2oBMI6nFWTRyRyxrJ E4eNwGR1IKkHoQRiq7FXYq7FXYq7FXYq7FXYq7FXYq7FXYqxj8zf+UI1L/nh/wBREeKu/LL/AJQj Tf8Anv8A9REmKsnxV2KuxV2KuxV2KuxV2KuxV2KpdrvmHRdBsGvtXvI7O2XYNId2P8qKKsx9lGKv EvN//OSF5Kz23la0FvH0F/dgNIfdIgSi/wCy5fIYaRbyXXPNPmPXZjLq+oz3rVqFlclF/wBVBRF+ gYUJVirsVdirsVTXRPNPmPQpRLpGoz2TVBKxOQjU3+JD8Df7IYq9a8of85IXkTJbearQXEXT6/aA LIPd4iQjf7Hj8jgpNvbdB8xaJr9gt/pF5HeWzftId1P8rqaMjezDAlMcVdirsVdirsVdirsVdirs VdirGPzN/wCUI1L/AJ4f9REeKu/LL/lCNN/57/8AURJirJ8VdirsVdirsVdirsVdirsVYJ+Zf5r6 R5NtzbxhbzXJVrBZA/CgPSSYjovt1P44q+Y/MnmnXfMmotqGsXTXM5qEU7JGpNeEadFX5ZJilOKu xVekUshoiM3yBOKqy6det0iP00H6zirm069XrEfoof1HFVF4pYzR0ZfmCMVWYq7FU28t+aNd8t6i uoaPdvbTigcDdJFBrwkQ7MvzxV9N/ln+bGk+crf6tKFs9diWs9lU8XA6yQk9V/yeo/HIsmeYq7FX Yq7FXYq7FXYq7FXYqxj8zf8AlCNS/wCeH/URHiq38sz/AM6Rpv8Az2/6iJMVZRXFXVxV1cVdXFXV xV1cVdXFXVxVgn5rfmXb+TtIEdsVl1y8UiygO4RehmkH8o7Dufpwq+Vr+/vNQvJr29ma4u7hjJNN IaszHqScLFD4qiLWynuT8Aoo6uegxVNrfSrWKhYeo/i3T7sVRgAAoBQDoBireKuxVogEUIqD1BxV B3GlW0tSo9N/Fen3YqlN1ZT2zfGKr2cdMVQ+Koiwv7zT7yG9spmt7u3YSQzRmjKw6EHFX1R+VH5m QectKMVzxi1yzUfXIV2Dr0E0Y/lP7Q7H6MDJnlcCurirq4q6uKurirq4q6uKurirF/zMP/Okal/z x/6iI8VW/lqf+dJ07/nt/wAn5MVZPXFXVxV1cVdXFXVxV1cVdXFUu8w67Y6Dot3q983G2s4zIw7s eiovuzEKMVfHvmjzJqPmTXLrV9Qas9y1VQElY0H2I0r+yo2yTFKcVej/AJT/AJT3Pmy5XUtSVofL 8DUZhVWuGU7xxnsv8zfQN+gSA356srSx826lZ2cSwWtvKI4YUFFVVUAAYUFIsVdirsVdirsVdiqe +RbK0vvNum2d5Es9rcSmOaFxVWVlIIOKhd+bP5TTeVJv0npfOfQZ3I3BLWzE7I57of2W+g79Qmnm uFCa+V/Meo+XNctdYsGpPbPUoSQsiHZ43p+yw2xV9h+XtesNe0W01exblbXkYkUHqp6Mjf5SMCpy LJMa4q6uKurirq4q6uKurirq4qxj8yj/AM6TqP8Azx/5Px4qt/LY/wDOl6d/z2/5PyYqyWuKurir q4q6uKurirq4q6uKvFvz/wBQ1PUUt9D0795b2hFxfxqTzaQr+7UCm/FG5dd+Q8MIQXgjKVJVgQRs QeowoZN+Xnky482+ZYNNUlLRP31/OP2IVI5UO/xN9lffAr630+xs9PsoLGyiWC0tkEcMKCiqq7AY GT5v/Mb/AJTjWP8AjOf+IjCGJY5hV2KuxV2KuxV2Ksj/AC5/5TjR/wDjOP8AiJwFQ+kL+xs9Qspr K9iWe0uEMc0LiqsrdQcDJ8k/mL5LuPKPmWbTmLPZyD1rCdv24WO1f8pT8Lff3woYvhQ9r/5x083m K8u/K9y/7u4BurCvaRQBKg/1kHL/AGJ8cBSHvVcCXVxV1cVdXFXVxV1cVdXFWNfmSf8AnS9R/wCe P/J+PFVn5cH/AJ0zTv8Ant/yfkxVkvLFXcsVdyxV3LFXcsVdyxVZLNHFG8sjBY41LOxOwAFSTirw bUL2W+vri8l2kuJGkZa148jXiK9l6DChItY8u2Gpgs6+lcdp0G/+yH7WKvWPyW8nr5e8rmeUA32p yGWWShH7pCVhAr241f8A2WKvQeWBL5r/ADF/5TfWP+M5/wCIjJMSxzFXYq7FXYq7FXYqyP8ALr/l N9H/AOM4/wCInFQ+lOWRZPOvzx8qprfk6W+iSt9o9bmIjcmHb11+XEc/9jhQ+YsKEz8s61LonmDT 9Wirysp0lZRtyQH41/2S1GKvsyKaOWJJY2DRyKGRh0KkVBGRZL+WKu5Yq7liruWKu5Yq7lirGvzH P/Omaj/zx/5Px4qs/Lo/86bp/wDz2/5PvirJK4q6uKurirq4q6uKuriqS+c7trbyvqEijkWj9Eg+ EzCIn6A+KvGcKFS2t5bm4it4RWWZ1jjHizGg/E4q94t4Ybe3it4V4Qwosca+CqKAb+wwJVK4q+bv zE/5TbV/+M//ABqMkxLHcVdirsVdirsVdirIvy7/AOU20j/jP/xqcVD6RrkWSyeKKeGSCZQ8MqlJ EPRlYUIPzGKvjHWtNk0zWL7TZPt2VxLbsfExuVr+GSYoLFX1v+WWpNqPkHQ7ljVhbLCx61MBMJP0 +ngSyeuBLq4q6uKurirq4q6uKsb/ADFP/Om6h/zx/wCT6Yqt/Ls/86dp/wDz2/5PvirI+WKu5Yq7 liruWKu5Yq7lirFvzIndPLnBWoJp40YeIAL0+9a4oeV4VTPyxCZfMWnKBWlxG/8AwDc/+NcVe1cs CXcsVeG/mFpsFz5o1FqcJeYo4/1F6jvhYlg91Zz2z8ZF2P2WHQ4VUcVdirsVdirsVZJ+W/8Aym+k /wDGVv8Ak22AqH0ZywMncsVfKX5tWv1b8xdbjoBymWXb/i6JJP8AjfCgsRwofTX5FXJk/Lu0jqT6 E88YB7VkL7f8HgKXoPLAl3LFXcsVdyxV3LFXcsVY5+Yh/wCdO1D/AJ4/8n0xVZ+Xp/50/T/+e3/J 98VZHyxV3LFXcsVdyxV3LFXcsVYt+Y8bP5dDAVEc6Mx8BRl/42xQ8uwqmfliYw+YdOcGhNxGn0O3 D/jbFXs/LAl3LFXjfnT/AJSjUP8AXH/EFwsSkUkaSIUdQynqDiqT3ujOlXtqsvePuPl44VSsgg0O xHUYq7FXYq7FWSflx/ym2lf8ZW/5NtgKh9E8sDJ3LFXyr+bN19a/MTW5ag8Zli2/4qiSP/jTCgsR wofTH5GQmL8vLV6EevPPICe9JCm3/AYEvQOWBLuWKu5Yq7liruWKu5Yqxz8wj/zp+of88f8Ak+mK rfy+P/OoWH/Pb/k8+FWRcsCHcsVdyxV3LFXcsVdyxVJvOFu9z5av40IBWMSmvhEwkb8FxV5DhVUg nkgnjniPGWJldG8GU1B+/FXt9vcxXEEc8R5RSoskbeKsKg/dgVU5Yq8d85/8pPf/AOuP+ILhQUlx V2Kq1l5Ou/MExS0i4sNnuTtGv+ue/wAuuKpF5j8q6z5fuvR1CGiMSIblPiikp/K38DvhVKMVdirI /wAuf+U10r/jK3/JtsBUPoflgSpzXEUEMk0rhIolLyOegVRUk/IYq+O9a1F9T1i+1F/tXlxLOQe3 qOWp+OSQgsVfWH5bWDaf5E0S2bZjbLMw6UM5MxH/AA+BLJeWBXcsVdyxV3LFXcsVdyxVjv5gn/nU L/8A54/8nkwpWeQD/wA6lYf89f8Ak8+KshrgQ6uKurirq4q6uKuriqyaOOaJ4pAGjkUo6noVYUIx V4re2slpdzWsn95A7RsexKmlRXscKqOKvS/IGr/WtJNnI1Z7I8RXcmNqlDv4br92KsorgV5D5y/5 Sa//ANcf8QXCgpMqszBVBLE0AG5JOKsz8u/l9NPxudWrDD1W1G0jf6x/ZHt1+WK0z+2tre1gWC2j WKFBRUQUAwJW3tlZ31s9reQpPbyCjxyAEH+33xV5P5v/AClubXneaByubfq1kd5U/wBQ/tj2+188 Nop5yysrFWBVlNGU7EEdjhVkX5d/8pppX/GRv+TbYCofQdcCWA/nP5oXR/KEtpE9L3Vq20ag7iIj 983y4/D/ALLCr5swoTLy5o8us69YaXHUNeTJEzDfipPxt/sVqcVfXsaJFGkcYCxoAqKOgAFAMild XFXVxV1cVdXFXVxV1cVY95/P/OpX/wDzy/5PJhSs8hH/AJ1Ox/56/wDJ58VZBXFDq4q6uKurirq4 q6uKurirz78wtKMV9HqSD93cgJKfCRRt/wAEo/DFWI4qj9E1abStRju4/iA+GWPpzQ/aX+I98Vet Wl5Bd20dzbuHhlHJGHh/Ud8VedaxoWo6t5rvo7SOqCRfUmbZE+Bep/h1xQy7QPKenaQokp695T4r hx0/1B+z+vFKe1xV1cVdXFXVxVi/mzyDo/mBWm4/VdRp8N3GPtH/AIsXbl+v3xV575e8r6xoHnzS 4b+GiNKwhuE3ikpG32W/gd8UPZLy+trK0mu7uRYbaBDJNK3RVUVJOKXy55/84T+afMM1+apZx/ur GE9ViU7E/wCUx+I/dihjeFXr35B+WGlvbrzHOn7u3BtrInvI4/eMP9VPh/2RwJe31xV1cVdXFXVx V1cVdXFXVxVj/n0/86nff88v+TyYpW+RD/zqlj/z1/5PPiqfVwIdXFXVxV1cVdXFXVxV1cVQmq6f DqNhNZy7LIPhburDdWHyOKvJb2zns7qW1nXjLExVh2+Y9j1GFVHFU98seZ5dIlMUoMljIayRjqp/ mX+IxV6RaXdrdQLcWrrJDJuHXv8AP3+eBVauKurirq4q6uKurirq4qpXdza28DXF06xwxfEXfoD0 FPfwxV5b571j/E1u+nq0kGnAhlCmjOy9GfsR/k/x6FXkWseXb/TWLOvq23adBt/sh+zhQs8vaFfa 7rFtpdivKe4anI/ZRRuzt7KN8VfVGg6PZaJpFrpdmtLe1QIp7serOfdmJJyKUfXFXVxV1cVdXFXV xV1cVdXFUh89n/nVL7/nl/yeTClZ5FP/ADqtj/z1/wCTz4qn1cUOrirq4q6uKurirq4q6uKurirH /NnlwapALi3AF9CKL2Ei9eJPj4Yq84dGRijgq6khlIoQR1BGKtYqjtK1rUNLl9S0kop+3E26N81/ iN8VZtpfnrTLkBLsG0m6VPxRk+zDp9I+nFWQw3EE8YkgkWWM9HQhlP0jFV9cVdXFVk1xDBGZJpFi jXq7kKo+k4qx7VPPWl2oZLSt3MNqr8MYPux6/wCxBxVhWq63qOqS87uSqj7EK7Rr8l/id8VQGKuE ZlIiCGQyHgIwORYttxA718MVZ/5H8kaf5djmulgSPUbynrld+CdfTU7gCu7U2r8hirKa4q6uKuri rq4q6uKurirq4q6uKpD56P8Azqt9/wA8v+TyYpWeRz/zq9l/z1/5PPiqe1xQ6uKurirq4q6uKuri rq4q6uKuriqQeY/K0Gp1uLciG9A3b9mT2anf3xVgF1aXNpO0FzGYpV6q36x4j3xVRxV2Kr4ppoXE kLtG46MhKn7xiqNi8wa5GarfTE/5Tl/+JVxV0vmHXJTVr6Yf6jlP+I0xVBSzTTOZJpGkkPV3JYn6 TiqzFXYqrWlndXk6wW0Zllboq/rJOwHucVegeXPK8GlgXExE18RTmPspXqEr+vFU+rirq4q6uKur irq4q6uKurirq4q6uKpF54P/ADq97/zy/wCTyYpW+ST/AM6xZf8APX/k6+KE85Yq7liruWKu5Yq7 liruWKu5Yq7liruWKu5YqhNQ02x1CH0ruISAfZboy/6rDcYqxDU/I97CS9i4uI+0bUWQff8ACfw+ WKscuLa4t39O4ieJ/wCV1Kn8cVU8VdirsVdiqrb2tzcyenbxPM/XiiljTx2xVkWm+RryUh7+QW8f eNCGkP07qPx+WKsw0/TrHT4fStIhGp+0erMfFmO564qiuWKu5Yq7liruWKu5Yq7liruWKu5Yq7li ruWKpH52P/OsXv8Azy/5OpiqzyUf+dZs/wDnp/ydfFU85DFXchiruQxV3IYq7kMVdyGKu5DFXchi ruQxV3IYq7kMVdyGKrJY4ZkMcyLIh6o4DA/QcVS2fyxoMzFmtFVj/vssg/4FSF/DFUE/kfRmNRJO nsrL/FTirk8j6MpBZ53HgzLT/hVGKo2DyzoMLBltFZv+LCzj7mJH4YqmUUcMSCOJFjjXoigKB9Ax VfyGKu5DFXchiruQxV3IYq7kMVdyGKu5DFXchiruQxV3IYq7kMVSPzqf+dZvP+ef/J1MVW+TD/zr Vn/z0/5OviqdcsCu5Yq7liruWKu5Yq7liruWKu5Yq7liruWKu5Yq7liruWKu5Yq7liruWKu5Yq7l iruWKu5Yq7liruWKu5Yq7liruWKu5Yq7liruWKu5Yq7liqS+cz/zrV5/zz/5OphVZ5OP/Ot2f/PT /k62Kp1XArq4q6uKurirD/Pn5jWXlhVtooxdapKvJIK0RFOwaQj8FHX2wqwuHzF+dWpw/X7KF47V xyRUggVSp6FBMC7D78VRGgfm/rFlqQ07zXbcAGCS3AjMUsRPeSPoR/qgfTirLvzI8z6honluLUdK lT1JJ40WQgSKUdGao7b0G+Ko7yHrV9rPlSx1K+ZWup/V9RlUKPgmdBsP8lRirIK4FdXFXVxV1cVd XFXVxVSupWjtZpF+0iMy/MAnFXnH5X+fPMPmHWbq11OSN4YrcyoEjCHlzVeo9mwq9MrgV1cVdXFX lXnL8z/MMHmWTQ/L8CF4nWHk0ZklklNKhVrSm9OmFWceTLzzHc6KsnmCH0NREjqU4hPgFOJoCRiq e1wK6uKurirq4q6uKurirq4q6uKpL5xP/Ot3n/PP/k6uFVvk8/8AOuWn/PT/AJOtgVOeWKu5Yq7l iruWKvCPKMC+bvzHkvL9fWg5yXkkZ3UpGQsSGv7IJQUPbbCr3flgViHnf8u7LzTcW1ybn6ncQKyP IsYcyKSCoPxL9nenzxVIfzO01tL/AC40/TmnNz9UuIYhMw4llWOQLtU0oNsIVj3lPWPzBv8AQbbR /LEQgtrAOLm8PD4nllaSnKTYUDjZRXviqO0D8wvN2j+Zo9F80N6sbyLDN6ioHiMlOLh46Bl3B77d MVZ356862/lfTFm4Ca+uCUtIDsCQPidv8laj/PfArALbVfzo1W2/S9nzW1I5woqW6Bl6/BG45uPD rXtXCrJvy7/MebXJ30nVo1h1aMExuo4iUJ9oFT9l16n+FMVUfzC/Mq60m+Gi6IiyakePrTFefpl6 FURP2nII/wA+iqRXN7+dWm2batcuzW6DnNGVtnKpsatGoqo8abjvTFWY+TvO6eaPL940qLDqFrGy 3US14HkrcXSpJoafRirAvyRkSLzBqEkjBI0smZ3Y0AAkQkknEqnGrfmR5k1vzCmleTFHpISDcMit 6m9DIeYISNe3f9WKvStLhvoLCKO/uvrl4B++nCLGCx68VUAADtgVDeZzrv6Duf0Dx/SvwfVuXCn9 4vP+8+H7HLrirweL/Fv+Ojw4/wCJfXav93x9XieXX930woet3fm3UvLXkyC+8xqJdcdnjECFAHkL sU3j+EKI6EkfrxSw2w1n83vM0T6hpsggswSIwgiiQkdQhkq7fMmmKo7yt+Z+uWuufoPzZGBK0gh+ sFFjeOQmg9QLRCh/mA99xiqa/mv5u13y/wDov9FTrD9Z9f1qoj19P0+P2wafbOIVix88/mV5kkP6 BhkjtoQqO0MaGrAbl5HHEE9eIpir2W3aT6vF6v8Ae8F9T/Wpv098CqnLFXcsVdyxVJvOB/51y7/5 5/8AJ1cVW+UD/wA67af89P8Ak62KU4rirq4q6uKurirwz8sp/wBCef5LC6ojyiaxYttRwwYD/ZNF QfPCh7nXAliXnr8wYfKslpELQXs1yHdo/V9IoqkAE/A9eRJp8sKLSH8zNSk1P8udP1CSD6s13PDN 6HLnxDxyFfiotdvbFU3/AChVV8k25UAF5pmY+J50r9wGJUMI/NKn/Kw7Q+MdtX/kYcQrf53SSHzN ZRk/u1slZQenJpZA3/ERiFLII7/86o41jj0i0REAVFDQAADYAD1sVSfSPKHn4+drXXr7Tlt+Vyst 28UsAUK20hCiRm3UmuKoXy+I5/zln+tUfjfXhjD7/FGJPT6/y8RTFXtMwieF1mAMTKRIG+zxI3rX tTAlj2l6f5OtIL5tAFqJngYTfVpBIeIBpUBm74oeF+XbDX9SuZtO0ZXaS6jKXIU8VMQIYh27LUD5 9MkhnH5N65a2Oo3eh3cKwXdy3KKZhxkLx7NC1fChKjxrgKQ9grgS6uKvFLX/AMnS3/MbJ/ybbChM Pz1eU3Gjoa+kEnKjtyJSv8MQpemeX4raHQtPjtafVltovSK9CvAEH6euBLyb87ordPMFjKlBcSW3 72ncK5CH9eEIKI/OWSWTTvLMk3968MzSf6xWAn8cQpejeTLK3svKulw26BVNtFI9O7yIHdj82bAq dVxS6uKurirq4qk/m8/867d/88/+Tq4qt8pH/nXrT/np/wAnGxVN64odXFXVxV1cVea/mN+XV7f3 p1zQx/puzXNup4MzJ0kjO3xbbj+OFUjh/M38wNPhFld2Cy3K/CJLiCVZdv5gpQE/Riqlo/k3zV5v 1sap5gWWC0JBmklUxsyDcRwoaUHvSg67nFWafmtpl3deU4LTTbSSdo7mLjBbxs5VFRx9lAdhtiqM /LCzvLLyhbW95BJbTrJKWimRo3ALkiqsAcVYd+Y+ia1d+ebW5tLC5uLdUtw00UMjoCrkmrKCNsVZ L+ZvkmfzDZw3dgAdSswwWMkD1Y2341OwIO4+nFWLaf8AmH570m0TTLvR2nuIEEcLzRSrJQbLyC/b 27ilfHFUx8i+VfMl75hbzP5iDwNyaSK3kqrPIw4gmP8AYVB0B36Yqh/zA8l65Z+YB5m8vxvKS6zS RxDnJHMvVgm/JWpU/T2xVB6j+YnnbV9Ok0qDSGiublTFLLDHKzFW2YKprxr474qyr8vvJlzoGgXs l4v+5K/T44lo3BFU8EqP2qsSafwxVIvyd0bWNP1W/e/sbi0R4FVGnieME8waAsBXEq1+Z3kvUo9X h1/QreWSaZwbiO2RmkSdN1lUICfipufH54q9B8ratfanosFxf2ktnfAencwzRtEea9WUMB8LdR93 bAqbVxV5Nb6Bri/mwdRNhOLD63I/1r029PiUIB5UpTCrMPzC8oN5l0dY7cquoWjGS1Ztg1RR4ye3 Kg38QMVYFpPnHz55WsxpF3pLTJDUW5mjkqq+Cunwug7U+/FW9F8peZvN3mP9M+YYWtrPkryCRDHz RD8MMaH4uPav4k4qnX5zaTquofof6hZT3fpfWfU9CJ5ePL0qcuANK0NMQrPPL6SRaDpsUqGOSO1h V0YEMrCNQQQehGBUfXFXVxV1cVdXFUo82n/nXrv/AJ5/8nFxSs8pn/cBa/8APT/k42FU3rih1cVd XFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxVD3eo2FmqteXMVsrmiGZ1QEjw5EYqqQ3EM8SzQSLL E4qkiEMpHsRscVVK4q6uKurirq4q6uKurirq4q6uKurirq4q6uKurirq4q6uKuriqUebD/uAuv8A nn/ycXFK3yqf9wNr/wA9P+TjYoTauKurirq4q6uKuriqyaeKGJ5pWCRRqXkdtgFUVJPyGKoTTdc0 jVPU/R93Fdejx9X0mDceVeNaePE4qu1LWdL0xEfULqO1SQkRtKwUEjcgVxV0utaVDp66jLdRpYuF K3JYBCG2Xf3xVCzebfLcNml7JqUAtpCRHJzB5FTQ8QNzT2xVvSvNXl7VpPT0+/inl6+kDxcgdSEb ix+7FU1riqS3/nTytp9wba71KGOcGjRglyp8G4BuP04qwf8AN7UrDUNG0q4sbiO5gM0gEkTBhXgN jTofbFWY/l+f+dN0r/jD/wAbHFUffeZvL9hL6N5qNvBMOsTyKGHzWtRiqIsNV03UIzJY3UV0g6tC 6vSvY8SaYqwn81/MNvDo/wBRs7/0tTiuIzLDFIVlCFGO/Eg0+IYqjfy28x6fP5d06wnv1l1ZvW5Q vJymNJZHFamv2N/lirK77UrGwgNxe3EdtCNvUlYKK+Ar3xVL7Dzj5Yv5xb2mpQSTN9mPlxLHwXlS p9hiqcVxVJtQ85eWNOlMN3qUMcq15RhubKR2ITkQfniqL0zXdI1RC+nXcVyF+0I2BYfNeo+nFUdX FXVxV1cVdXFXVxV1cVSnzUf9wN1/zz/5OLiq3ysf9wVr/s/+TjYqU1rgV1cVdXFXVxV1cVS/zEf+ df1P/mEn/wCTbYVeffkif+O1/wBG3/M3EoRH51n/AHHaZ/xmk/4iMQrXmA/8gfsv+MVr/wASGKUp /LfyNYa3aSajq/Oa1icwW1sGZQafEzEqQaVbYA9a4oW/mF5Jt/LottY0V5IIfVCMnIlopN2Rkcnl T4cVZDrHna8P5aW+qxv6d/fUtTKhoVkBYSOKdCRGxHhXFKTeQfy40/VtLGrau0jpOzfV4EbiCqkq Wcjfdht/bihKPzE8nReXbiB7GR2067qVjc1KSJ1HauzbfTirO9JGtv8AljZx6IP9yMkASJuSoVBk PNgW2rxrTFKQaB+WFjFbS3Pmyf6vMzH0ohOijiNy7PvUk++KEjjfT/L/AOYFougXjXFiZoo3ZXDA rIwWSPkvwuP8+2Ksj/Nvy3pkVo+vIH+v3M8UUhLfBxEZXZaeEYxVF/lj5S0f9F6b5ipJ+kf3+/L4 PtyQ/Zp/JirFLm8HnTzk66hfLZ6VCX9JndUVYUNAE5Hjzk2r/QUxVMPNfkvydbaRJd6LqkZu7Ycz A1xHJ6ijrQDflTcUxVMtB806vqH5caqEmc6ppyGMTgnmYiAQ3Ib8gnIV9q4pYn5JXyLKbhPMxcTu R9XdmkWMDvvFvyr/ADbYoZVpfkCa31+LWPK+q276dHIjBfUZ2KbF4mMYIIPvir06uBLq4q6uKuri rq4q6uKpV5pP+4K6/wBh/wAnFwqFvlc/7grb/Z/8nGxVNa4FdXFXVxV1cVdXFUBr4Z9C1JFFWa1m CgdyY2xV5v8Akte28d5qdo7hZ7hIXhU/tCIvyp7jmMJQrfnPqNq/6PsEcNcxs8sqA7orABeX+tiE ojzAf+QQWX/GK2/4kMVXfk/r1mdNm0eSRUu45WlhRiBzRwK8fEqRviVVPzg1m0TSIdKV1a7mlWVo walY0B3PhUkUxCpPqmj3SflFp5KnlFOLyVSNxHIZFU/dIpxQyn8rdas7vyzBYo4F3Y8kmi2B4s5Z XA8CGpXxxSxv85NZs55LLS4ZBJPbs8twFNQhYAKp9+pxCou+1zUNI/KrS5bFzFPccbczD7SK3qMS p7H4KVxVDeS/y/0XW9Ij1jU7qa6nnZucavQIVYijndi1BXqOuKsd1qDQ7Pz1bW+jlRY289spZXLr zDKXPMk1364oZ9+b9T5Ujp2uo6/8A+ISjfywljbyTYKrBmjMyuAalSZnah+gg4q8u8t6Nox80y6R 5gZoY1MkKOG9MCZG+Hkx7MAQPemKGc635A8g6Np8t9fG4WKMbKJRzduyoCBVjilU8o6n5U0ny7qe s6VaXwsY3RbhZRGzsVoPgAelF9SrVOKqeneX/wAvfOUE13Y2stjLG/GVIysTioBDemDJGFPYgYqw 3zFp0vkrzHD+idQMkioJQdg61JHpygbEED6fDFD3KKQvEjkcSyglT1FRWmBK+uKurirq4q6uKuri qVeaD/uCuf8AYf8AJxcKrPLJ/wBwlt/s/wDk42KlNOWKu5Yq7liruWKu5Yq6uKvO9Y/KG1nvHuNM vTZo7Fvq7pzVSd/gYMpA8B+OKr1/J7ShYiFr6RrouGe5CAVABHFUqaDevU4qiPPenppv5dfo9HMi W3oRq52JCuBWgxVjPlDyDp/mLy2bozvaXsdxJGJlHNSoVSAyEr0J7EYoT3S/yf063u1n1C+e+iU8 vQEfpBj/AJZ5uSPlTFLPpYIJbdreSNWgdTG0RA4lCKFaeFMVef335O2T3TS6fqUlnExqImj9UrXs GDxmnzxVePye0r6mInvpWui4Z7niNwARxCVNKk16nFWSHyjpsvliLy/ds01vEtEmFFcMCSrr1AIr irEv+VNRrIeGsOsJO6ej8RHgWEgH4YoRN9+T2kyQQJZXsltLGCJpZFEvqEmoNAY+NPbFLI28pWk/ lWPy9eTNNHGgUXIHF+atyDgEtTFUk8ufljFomu2+qJqJnFvz4wmIKTzRk+1zPTl4Yqj/ADX+Xuk6 /N9b5tZ35ADToAwcAUHNDSpHjUYqx+1/JtPVU3uqtLAh2jjj4kr/AKzM3H7sUM/tNK06001dNggV bJUMfo0qCrfa5V68q71xSwa+/KGAXLT6TqclmrV4xOpegPYOrIafMHFUXoP5V6XYXiXmoXLajOjc 1RlCR8vFlJctv7/RirOeWKu5Yq7liruWKu5Yq7liqV+Zj/uEuf8AYf8AJxcVC3y2f9wtt/s/+TjY qUzrirq4q6uKurirq4q6uKurirq4qlnmLRLfXNLk06eR4o5GVi6U5fAa964qs8s+Xrby/pzWNvK8 0bSNKWkpWrACmwH8uKptXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV 1cVdXFXVxVLPMh/3C3P+w/5OLioW+XD/ALhrf/Z/8TbFSmVcVdXFXVxV1cVdXFXVxV1cVdXFXVxV 1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxV1cVdXFXVxVLfMZ/3 DXH+w/4muKhfc21x5anl07UYnS2R2NpdhS0bxs1RuK0O+4xSQpf4j0f/AJaP+Ef/AJpxRTv8R6P/ AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8 R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04 rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/ AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH /CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/ AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8 R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04 rTv8R6P/AMtH/CP/AM04rTv8R6P/AMtH/CP/AM04rSrb29x5lmj07Tone3kdTd3ZQrHHGrVO5pvt sMU0/wD/2Q== xmp.iid:5B0DF43F2F37E811B301980F8332B901 xmp.did:5B0DF43F2F37E811B301980F8332B901 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf uuid:e4605c3c-53b1-4c1c-b17e-d25e6ce6c450 xmp.did:0980117407206811822A897E387FE54C uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:5B0DF43F2F37E811B301980F8332B901 2018-04-03T19:09:44+08:00 Adobe Illustrator CS6 (Windows) / Print False False 1 210.001652 296.999959 Millimeters Cyan Magenta Yellow Black Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 14.999998 100.000000 90.000004 10.000002 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000004 84.999996 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000001 94.999999 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000002 84.999996 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000001 0.000000 90.000004 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 19.999999 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 84.999996 10.000002 100.000000 10.000002 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000004 30.000001 94.999999 30.000001 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000001 10.000002 44.999999 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 69.999999 14.999998 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 84.999996 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 94.999999 5.000001 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000002 100.000000 35.000002 10.000002 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000002 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 94.999999 19.999999 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 39.999998 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 39.999998 44.999999 50.000000 5.000001 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000002 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000001 60.000002 64.999998 39.999998 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 39.999998 64.999998 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000001 50.000000 75.000000 10.000002 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000002 60.000002 80.000001 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 39.999998 64.999998 90.000004 35.000002 C=40 M=70 Y=100 K=50 CMYK PROCESS 39.999998 69.999999 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 69.999999 80.000001 69.999999 Grays 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999402 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998797 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999701 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999102 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999402 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998803 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999701 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999102 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998803 Brights 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000002 94.999999 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 84.999996 10.000002 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000004 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000002 90.000004 0.003099 0.003099 Adobe PDF library 10.01 endstream endobj 537 0 obj<> endobj 538 0 obj<> endobj 539 0 obj<> endobj 540 0 obj<> endobj 541 0 obj<> endobj 542 0 obj<> endobj 543 0 obj<> endobj 544 0 obj<> endobj 545 0 obj<> endobj 546 0 obj<> endobj 547 0 obj<> endobj 548 0 obj<> endobj 549 0 obj<> endobj 550 0 obj<> endobj 551 0 obj<> endobj 552 0 obj<> endobj 553 0 obj<> endobj 554 0 obj<> endobj 555 0 obj<> endobj 556 0 obj<> endobj 557 0 obj<> endobj 558 0 obj<> endobj 559 0 obj<> endobj 560 0 obj<> endobj 561 0 obj<> endobj 562 0 obj<> endobj 563 0 obj<> endobj 564 0 obj<> endobj 565 0 obj<> endobj 1 0 obj<> endobj 2 0 obj<> endobj 3 0 obj<> endobj 4 0 obj<> endobj 5 0 obj<> endobj 6 0 obj<> endobj 7 0 obj<> endobj 8 0 obj<> endobj 9 0 obj<> endobj 10 0 obj<> endobj 11 0 obj<> endobj 12 0 obj<> endobj 13 0 obj<> endobj 14 0 obj<> endobj 15 0 obj<> endobj 16 0 obj<> endobj 17 0 obj<> endobj 18 0 obj<> endobj 19 0 obj<> endobj 20 0 obj<> endobj 21 0 obj<> endobj 22 0 obj<> endobj 23 0 obj<> endobj 24 0 obj<> endobj 25 0 obj<> endobj 26 0 obj<> endobj 27 0 obj<> endobj 28 0 obj<> endobj 29 0 obj<> endobj 30 0 obj<> endobj 31 0 obj<> endobj 32 0 obj<> endobj 33 0 obj<> endobj 34 0 obj<> endobj 35 0 obj<> endobj 36 0 obj<> endobj 37 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 38 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 39 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 40 0 obj<>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 41 0 obj<>stream /GS1 gs BT /F6 1 Tf 10.0001 0 0 10.0001 175.748 710.0786 Tm 0 0 0 1 k 0.0161 Tc 0 Tw [(on)-518.7(DSS-induced)-517.4(colitis)-519.7(were)-511.4(found)-511.7(t)-4.7(o)-514.7(a)-1.1(ss)]TJ 19.61 0 TD [(ociate)-517(with)-518.7(PD-1)-514.7(upregulati)-5.3(on)-513(and)-517.4(M)4.7(2)]TJ -19.61 -1.4003 TD 0 Tc [(macrophage)-424.4(polarization.)-427.3(Thus,)-426.3(PD-1-mediated)-427.3(M2)-423.2(macrophage)-430.1(polarization)-425.2(is)-421.2(a)-425.4(key)]TJ T* [(mechanism)-301.1(of)-303.5(helminth-induced)-305.3(modulation)-302.4(of)-303.5(the)-300.8(host)-301.4(immune)-303.4(system.)]TJ /F1 1 Tf 6.9999 0 0 6.9999 175.748 663.1368 Tm 0.0125 Tc [(Ke)12.5(yw)12.5(o)-5.1(r)12.5(ds)12.5(:)-506.7(i)3.3(n)]TJ /F10 1 Tf 6.4307 0 TD 0 Tc ()Tj /F1 1 Tf 0.6074 0 TD [(a)-11.1(m)-12.1(ma)-15.2(to)-16.8(ry)-522.4(bo)-15(wel)-528.5(di)-12.6(s)-11.6(e)0(a)-14.2(s)0(e)-14.7(,)]TJ /F2 1 Tf 13.2097 0 TD 0.0106 Tc [(T)10.6(r)-4.7(ic)10.6(hine)10.6(lla)-502.7(s)10.6(pira)10.6(lis)]TJ /F1 1 Tf 8.8767 0 TD 0 Tc [(,)-515.6(m)0(a)-15.2(c)-11.1(ro)-15.3(ph)-11.7(a)-11.1(g)0(e)-14.6(s)0(,)-519.2(p)-11.5(ro)-15.3(gr)-15.3(am)-15.2(me)-15.2(d)-513.7(d)-11.5(ea)-14.2(th)-523.8(1,)-522.5(ex)-14.7(c)-11.1(r)0(e)-14.9(t)0(o)-16.8(r)0(y)-12.1(/)]TJ -29.1245 -1.4254 TD [(secretory)-304.6(products)]TJ 11.9999 0 0 11.9999 45.3543 613.1337 Tm (INTRODUCTION)Tj /F11 1 Tf 9.5 0 0 9.5 45.3543 593.1211 Tm [(Ep)-10.1(id)-7.7(e)-7.7(m)0(i)-8.2(o)-7.2(lo)-7.9(gi)-10.1(cal)-466.5(st)-8.3(ud)-10.3(i)-8.5(e)0(s)-461.3(a)0(r)-10.6(e)-461.2(in)-10.6(cr)-7.7(e)-7.7(asi)-13.2(ng)-9.5(ly)-461.7(re)-13.7(por)-12.4(ti)-10.9(ng)-463.1(an)-466.2(inv)-12.1(er)-7.7(se)]TJ 0 -1.2114 TD [(as)19.2(s)11.9(o)0(c)20.8(i)0(a)16.7(t)0(i)24.9(o)0(n)-343.5(b)0(e)20.8(t)15.6(we)18.8(en)-338(th)15.4(e)-347.9(p)12.7(re)16.1(va)23.7(le)21.5(nc)20.1(e)-353.8(o)0(f)-336.9(a)13.3(ut)16.4(oi)20(m)12.3(m)12.3(u)0(n)16.7(e)-347.9(di)22.1(se)16.1(a)13.3(s)0(e)16.1(s)-346.2(an)17.2(d)]TJ 0 -1.2055 TD [(h)11.8(e)0(l)21.5(m)0(i)15.7(n)0(t)19.5(h)-226.9(in)19.2(fe)20.7(ct)19.8(io)20(ns)15.8(.)-229.6(T)0(h)17.1(e)0(r)22.1(e)-234.5(h)11.8(a)13.3(s)-232.8(b)0(e)20.9(e)0(n)-224.6(g)0(r)22.3(o)0(w)19.3(i)0(n)19.2(g)-234.2(in)19.2(t)15.6(e)0(r)16.1(e)0(s)22.1(t)-235.1(in)-219.5(ex)18.7(pl)18.1(oi)20(t)15.6(i)0(n)19.2(g)]TJ 0 -1.2114 TD [(th)21.4(e)-306.1(i)15.3(mm)18.7(un)16.7(or)22.6(eg)20.6(ul)18.1(a)13.3(t)0(o)20.2(r)0(y)-294(c)0(a)17.5(p)12.7(ab)18(il)20.7(it)24.9(ie)19.6(s)-304.4(o)0(f)-295.1(h)11.8(el)21.5(m)12.3(i)0(n)19.2(t)0(h)21.4(s)-304.4(to)-290.1(de)17(ve)20.6(lo)21.9(p)-303.5(n)0(o)20.5(v)0(e)20.6(l)]TJ T* [(th)21.4(er)22.1(ap)14.1(i)15.3(e)0(s)-204.7(f)0(o)21.2(r)-208.9(tr)21.5(ea)17.5(tm)21.9(en)20.1(t)-211.2(o)0(f)-199.6(a)0(u)20.1(t)0(o)20.2(i)0(m)21.7(m)0(u)19.1(n)0(e)-200.7(i)0(n)]TJ /F12 1 Tf 16.1186 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(ma)19.7(to)20.2(r)11.9(y)-210.4(di)16.1(s)11.9(e)0(a)17.5(s)11.9(es)-198.7(an)17.2(d)]TJ -16.6378 -1.2114 TD [(al)18.6(le)21.5(r)11.9(g)0(i)19.8(c)-252.4(d)12.7(i)0(s)21.3(e)0(a)17.5(s)11.9(es)-240.5(\()]TJ 0 0 0 0.7 k 6.6838 0 TD (1)Tj 0 0 0 1 k 0.4655 0 TD [(\).)-244.6(U)12.9(l)0(c)21.5(e)0(r)16.1(a)13.3(ti)18.9(ve)-242(co)20.8(li)20.7(t)15.6(i)0(s)-241.3(a)0(n)17.2(d)-249.8(Cr)23.4(oh)22.5(n)]TJ /F13 1 Tf 11.816 0 TD (?Tj /F11 1 Tf 0.2089 0 TD [(s)-250.7(d)0(i)16.1(s)11.9(ea)23.5(se)-240.5(ar)19.2(e)-252.4(t)0(w)24.2(o)]TJ -19.1741 -1.2114 TD [(we)-11(ll)-7.3(-es)-11.8(t)-8.3(abl)-12.5(is)-8.6(he)-7.8(d)-458.7(f)-7.4(or)-7.3(ms)-465.1(of)-462.2(in)]TJ /F12 1 Tf 11.7085 0 TD ()Tj /F11 1 Tf 0.5371 0 TD [(am)-10.2(mat)-12.5(or)-7.3(y)-461(b)0(o)-8.5(wel)-465.2(di)-7.7(se)-13.7(as)-10.6(es)-461.3(\(I)-10.3(BD)-6.9(\))]TJ -12.2456 -1.2114 TD [(ch)22(ar)19.2(ac)17.5(te)19.8(r)11.9(i)0(z)19.6(e)0(d)-317.2(a)13.3(s)-328.2(c)0(o)20.8(m)12.3(pl)18.1(ex)18.7(,)-325.1(i)0(m)21.7(m)12.3(un)16.7(e-)18.1(m)12.3(e)0(d)22.9(i)0(a)16.7(t)0(e)19.8(d)-327.4(d)12.7(i)0(s)21.3(o)0(r)16.6(d)12.8(er)22.1(s)-328.3(\()]TJ 0 0 0 0.7 k 22.3071 0 TD (2)Tj 0 0 0 1 k 0.4655 0 TD [(\).)-316.2(Pr)18.9(io)20(r)]TJ -22.7726 -1.2114 TD [(r)11.9(e)0(s)16.1(e)0(a)23.5(r)0(c)16.1(h)-220.9(ha)19.1(s)-226.8(d)12.8(es)16.1(cr)22.1(ib)20(ed)-215.8(th)21.4(e)-222.5(p)0(r)18.7(o)0(t)20.2(e)0(c)20.4(t)0(i)18.9(v)0(e)-212.1(e)0(f)80.4(f)0(e)20.7(c)0(t)19.8(s)-226.8(of)-211.6(h)11.8(e)0(l)21.5(m)0(i)15.7(n)0(t)19.5(h)-220.9(in)19.2(fe)20.7(ct)19.8(io)20(ns)]TJ 0 -1.2055 TD [(and)-459.4(speci)]TJ /F12 1 Tf 3.9387 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(call)-7.6(y)-449.1(h)0(e)-7.8(lminth-d)-10.6(erived)-460.3(proteins)-462.8(on)-450.9(vari)-8.7(ous)-454(IBD)-455.6(in)]TJ -4.4698 -1.2114 TD [(an)17.2(i)15.3(m)0(a)19.7(l)-281.1(mo)17(d)12.7(e)0(l)21.5(s)-286.5(a)13.3(s)-280.5(we)18.8(ll)-269.8(as)-273.2(pl)18.1(a)13.3(c)0(e)20.4(b)0(o)21.3(-)0(c)18.1(o)0(n)20.5(t)0(r)21.5(o)0(l)21.9(l)0(e)15.5(d)-279.7(h)11.8(u)0(m)19.1(a)0(n)-275.2(c)0(l)21.5(i)0(n)19.2(i)0(c)19.6(a)13.3(l)-281.1(t)0(r)21.5(i)0(a)16.7(l)0(s)]TJ T* (\()Tj 0 0 0 0.7 k 0.3342 0 TD (3)Tj 0 0 0 1 k 0.4655 0 TD (,)Tj 0 0 0 0.7 k 0.4297 0 TD (4)Tj 0 0 0 1 k 0.4714 0 TD [(\),)-202.9(s)11.9(u)12.7(gg)14.9(es)22.1(ti)18.9(ng)-200.5(th)21.4(e)-210.6(p)0(o)17.4(t)15.6(en)20.1(ti)18.9(al)-202.2(ap)20.1(pl)18.1(ic)19.6(a)13.3(t)0(i)18.9(o)0(n)-200.3(o)0(f)-199.6(h)11.8(el)15.5(m)12.3(i)0(n)19.2(t)0(h)-199.4(i)0(n)19.2(f)0(e)20.7(c)0(t)19.8(i)0(o)20(n)-210.9(or)]TJ -1.7008 -1.2114 TD [(h)11.8(e)0(l)21.5(m)0(i)15.7(n)0(t)19.5(h)11.8(-)13.8(d)0(e)17(r)11.9(iv)19.8(ed)-221.7(pr)18.7(od)17.4(u)12.7(c)0(t)19.8(s)-232.8(in)-225.4(IB)20.8(D)-231.8(t)0(h)21.4(e)0(r)22.1(a)0(p)20.1(y)0(.)-225.1(M)0(e)17.9(c)0(h)22(a)0(n)17.2(i)15.3(st)15.5(ic)-219.1(st)21.5(ud)19.5(ie)19.6(s)-232.8(t)0(o)]TJ T* [(da)20.1(te)-171.2(h)11.8(a)0(v)17.8(e)-180.8(m)12.3(a)0(i)22.7(n)0(l)15.2(y)-180.5(fo)21.2(cu)22.9(se)16.1(d)-178.2(o)0(n)-170.4(t)0(h)21.4(e)-180.8(r)11.9(o)0(l)16(e)0(s)-168.9(o)0(f)-169.8(t)0(y)20(p)12.7(e)-180.8(2)-183.4(im)21.7(m)12.3(u)0(n)16.7(i)0(t)18.9(y)-180.5(m)12.3(e)0(d)22.9(i)0(a)16.7(t)0(e)19.8(d)]TJ T* [(by)-259.4(Th)23.1(2)-267(a)0(n)17.2(d)-267.7(r)11.9(e)0(g)20.6(u)0(l)18.1(a)0(t)22.9(o)0(r)16.6(y)-264.1(T)-269.2(c)0(e)20.4(l)0(l)16.6(s)-268.6(\()]TJ 0 0 0 0.7 k 12.2158 0 TD (4)Tj /F13 1 Tf 0 0 0 1 k 0.4714 0 TD (?Tj /F11 1 Tf 0 0 0 0.7 k 0.5013 0 TD (6)Tj 0 0 0 1 k 0.4655 0 TD [(\).)-262.5(H)14(o)0(w)19.3(e)0(v)20.6(e)0(r)22.1(,)-271.3(s)11.9(o)0(m)17(e)-264.3(re)16.1(p)12.8(o)0(r)16.6(t)15.6(s)-268.6(h)0(a)19.1(v)0(e)]TJ -13.654 -1.2055 TD [(i)-8.5(m)0(p)-16.7(l)-6.6(i)-8.5(c)-7.7(a)-10.6(t)-8.3(e)-7.7(d)-464.7(t)-8.3(h)-12.1(at)-472.4(t)-8.3(h)0(e)-473.3(m)0(a)-16.1(c)-7.7(r)-12(o)-7.3(ph)-17.2(ag)-12.1(e)-467.2(p)-11.1(o)-7.2(p)-11.1(ul)-11.8(a)-10.6(t)-8.3(i)-8.5(o)-7.3(n)-8(s)-465.5(a)-10.6(r)0(e)-473.2(i)-8.5(n)-8(v)-7.5(o)-7.3(l)-6.6(v)-13.4(e)-7.7(d)-464.7(i)-8.5(n)]TJ 0 -1.2114 TD [(h)11.8(e)0(l)21.5(m)0(i)15.7(n)0(t)19.5(h)11.8(-)13.8(g)0(e)20.6(n)0(e)14.1(r)11.9(a)13.3(t)0(e)19.8(d)-231.9(pr)18.7(ot)20.2(ec)20.4(ti)18.9(on)-218.2(a)13.3(g)0(a)17.8(i)0(n)19.2(s)11.9(t)-229.1(i)0(n)19.2(t)0(e)19.8(s)11.9(ti)18.9(na)17.2(l)-227.4(p)12.7(at)16.9(h)11.8(o)0(l)21.9(o)0(g)21.1(y)-234.2(\()]TJ 0 0 0 0.7 k 23.3992 0 TD (7)Tj /F13 1 Tf 0 0 0 1 k 0.4714 0 TD (?Tj /F11 1 Tf 0 0 0 0.7 k 0.5013 0 TD (9)Tj 0 0 0 1 k 0.4655 0 TD (\).)Tj -23.5722 -1.2114 TD [(M)13.7(a)0(c)17.5(r)11.9(op)17.4(h)11.8(a)0(g)17.8(e)0(s)-180.8(a)0(r)19.2(e)-192.7(a)-195.6(v)0(e)20.6(r)11.9(s)11.9(a)0(t)16.9(i)0(l)20.7(e)-192.7(ce)20.4(ll)-186.3(p)12.7(o)0(p)17.4(u)12.8(la)18.6(ti)24.9(on)-188.3(t)15.6(h)0(a)19.1(t)-193.3(pl)18.1(a)13.3(y)0(s)-186.5(v)0(i)19.8(t)0(a)22.9(l)-191.6(ro)16.6(le)21.5(s)]TJ -1.2651 -1.2114 TD [(in)-320.9(cl)21.5(ea)17.5(r)11.9(i)0(n)19.2(g)-329.7(ba)23.9(ct)19.8(er)22.1(ia)-323.5(fr)22.4(om)-317.2(lo)16(ca)23.5(l)-328.9(t)0(i)18.9(s)11.9(su)18.7(es)22.1(,)-331(t)0(r)21.5(a)0(n)17.2(s)11.9(la)18.6(ti)18.9(ng)-319.9(a)13.3(l)0(e)21.5(r)0(t)-318.7(s)0(i)15.3(g)0(n)20.3(a)13.3(ls)-317(to)]TJ T* 0.0314 Tc [(other)-475.9(i)-1(mmune)-477.6(cells,)-478.7(s)1.5(ecretin)5.5(g)-483.3(c)-0.2(yt)5.2(oki)5(n)-0.5(es)-481.8(to)-477.1(establish)-481.9(l)0.9(ocal)]TJ T* 0 Tc [(h)11.8(o)0(m)17(e)0(o)20.8(s)11.9(ta)22.9(ti)18.9(c)-425.4(i)0(m)21.7(m)12.3(un)16.7(e)-419.5(c)0(e)20.4(l)0(l)-413.1(n)0(e)20.1(t)0(w)18.2(o)0(r)22.6(k)11.6(s,)-414.6(an)17.2(d)-422.9(p)12.8(ar)19.2(ti)18.9(ci)19.6(p)12.8(a)0(t)16.9(i)15.3(ng)-415.3(in)-410.4(T)-424.4(c)0(e)20.4(l)0(l)]TJ T* [(re)16.1(st)15.5(im)15.7(ul)12.1(at)16.9(io)14(n)-431.7(a)0(n)17.2(d)-434.8(ma)13.7(in)13.3(te)19.8(na)11.2(nc)14.1(e)-431.4(w)0(i)12(t)0(h)21.4(i)0(n)-428.3(t)0(h)15.4(e)-437.4(la)18.6(mi)15.7(na)-430.4(pr)18.7(op)11.5(ia)-424.9(\()]TJ 0 0 0 0.7 k 24.163 0 TD (10)Tj 0 0 0 1 k 0.9429 0 TD (\).)Tj -25.1059 -1.2055 TD [(A)12.7(c)0(t)19.8(i)0(v)19.8(a)0(t)16.9(e)0(d)-418.7(m)12.3(a)13.3(c)0(r)16.1(o)0(p)23.4(h)0(a)19.1(g)0(e)20.6(s)-429.7(a)13.3(r)0(e)-419.5(f)0(u)17.3(n)0(c)20.1(t)0(i)18.9(o)0(n)20.5(a)13.3(ll)22.6(y)-431.2(d)12.7(iv)19.8(id)16.1(ed)-412.7(in)19.2(to)-421.4(t)15.6(w)0(o)-416.4(m)0(a)19.7(i)0(n)]TJ 0 -1.2114 TD [(ca)17.5(t)15.6(e)0(g)14.7(o)0(r)22.6(i)0(e)19.6(s)11.9(:)-134.1(t)0(h)21.4(e)-127.1(M1)-122(ty)20(pe)-120.3(\(t)18.4(h)11.8(e)-133(cl)21.5(as)19.2(s)11.9(i)0(c)19.6(a)0(l)18.6(-)13.8(ac)17.5(ti)18.9(va)23.7(te)19.8(d)-130.5(m)0(a)19.7(c)0(r)16.1(o)0(p)23.4(h)11.8(ag)17.8(e\))-118.2(an)17.2(d)-130.5(t)0(h)21.4(e)]TJ T* [(M2)-301(ty)20(p)12.7(e)-312.1(\(t)18.4(h)11.8(e)-312.1(al)18.6(te)19.8(r)11.9(n)0(a)17.2(t)0(i)24.9(v)0(e)14.7(l)0(y)-300.5(a)13.3(ct)19.8(iv)19.8(at)22.9(ed)-305.3(m)12.3(a)0(c)17.5(r)11.9(op)17.4(h)11.8(a)13.3(ge)14.7(\))-307.5(\()]TJ 0 0 0 0.7 k 20.1528 0 TD (11)Tj 0 0 0 1 k 0.9369 0 TD [(\).)-304.3(A)12.7(l)0(t)20.9(h)11.8(ou)17.4(gh)]TJ -21.0897 -1.2114 TD [(M1-type)-447.1(macrophages)-450.1(release)-452.1(proin)]TJ /F12 1 Tf 14.8654 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ammatory)-449.2(cytokines)-449.3(and)]TJ -15.3966 -1.2114 TD [(en)20.1(h)11.8(a)0(n)17.2(c)0(e)-361.5(i)0(n)]TJ /F12 1 Tf 4.3922 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(ma)19.7(to)20.2(r)11.9(y)-377.5(r)11.9(e)0(s)22.1(p)0(o)17.4(n)0(s)21.8(e)0(s)22.1(,)-378.8(t)15.6(h)0(e)16(y)-371.5(a)13.3(l)0(s)17.2(o)-371.3(ca)17.5(u)12.8(s)0(e)-365.8(i)0(n)19.2(j)0(u)24(r)0(y)-365.6(t)0(o)-361.7(h)11.8(os)22.6(t)]TJ -4.9114 -1.2114 TD -0.0119 Tc [(t)-11.9(i)7(ssu)-11.9(e)-341(\()]TJ 0 0 0 0.7 k 2.8466 0 TD -0.0135 Tc (12)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc [(\).)-322.2(On)-325.3(th)21.4(e)-335.9(c)0(o)20.9(n)0(t)19.5(r)0(a)19.2(r)11.9(y,)-326.6(M2)21.3(-t)17.5(yp)23.2(e)-335.9(m)0(a)19.7(c)0(r)16.1(o)0(p)23.4(h)11.8(ag)17.8(es)-324(r)11.9(e)0(l)15.5(e)0(a)23.5(s)0(e)-324(a)0(n)17.2(t)0(i)18.9(-)]TJ -3.7835 -1.2055 TD 0.0264 Tc (in)Tj /F12 1 Tf 0.8534 0 TD 0 Tc ()Tj /F11 1 Tf 0.555 0 TD 0.0262 Tc [(ammatory)-476.6(cytokines)-475.1(a)-2.3(nd)-474.3(help)-480.2(maintain)-477.1(tissue)-476.8(immune)]TJ -1.4084 -1.2114 TD 0 Tc [(h)11.8(o)0(m)17(e)0(o)20.8(s)11.9(ta)22.9(si)15.3(s)11.9(,)-360.9(th)15.4(u)12.7(s)-364.1(av)17.8(oi)20(d)12.7(i)0(n)19.2(g)-365.5(ov)21.1(er)22.1(ac)17.5(t)15.6(i)0(v)19.8(e)-365.8(in)]TJ /F12 1 Tf 16.1783 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(m)12.3(a)0(t)16.9(i)0(o)20(n)-360.1(\()]TJ 0 0 0 0.7 k 4.7264 0 TD (13)Tj 0 0 0 1 k 0.9369 0 TD (,)Tj 0 0 0 0.7 k 0.5848 0 TD -0.0135 Tc (14)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc [(\).)-352.1(In)]TJ -23.8826 -1.2114 TD [(th)21.4(e)]TJ /F12 1 Tf 1.5576 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(gh)22.2(t)-330.6(a)0(g)17.7(a)13.3(in)19.2(s)11.9(t)-330.6(fo)21.2(r)11.9(e)0(i)19.6(g)0(n)-319.9(p)0(a)20.1(t)0(h)21.4(o)0(g)21.1(e)0(n)20.1(s)0(,)-319.1(t)0(h)15.4(e)-324(sh)17.8(if)19.9(ti)18.9(ng)-313.9(ba)18(la)18.6(nc)20.1(e)-330(b)0(e)20.8(t)15.6(we)18.8(en)]TJ -2.0767 -1.2114 TD [(pr)18.7(oi)20(n)]TJ /F12 1 Tf 2.1364 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(m)12.3(a)0(t)16.9(o)0(r)22.6(y)-335.7(M1)-330.8(a)13.3(n)0(d)-329.5(w)0(o)19.3(u)12.7(nd)16.7(-)13.8(h)11.8(ea)17.5(li)20.7(ng)-325.8(M2)-330.8(m)12.3(a)0(c)17.5(r)11.9(op)23.4(ha)19.1(ge)20.6(s)-340.2(o)0(v)21.1(e)0(r)]TJ -2.6556 -1.2114 TD [(ti)18.9(m)12.3(e)-389.6(is)-384.5(es)22.1(se)16.1(nt)19.5(ia)22.7(l)-388.5(f)0(o)15.2(r)-387.9(pr)18.7(op)17.4(er)-377.7(re)16.1(s)11.9(o)0(l)21.9(u)0(t)16.4(i)15.3(on)-385.3(of)-378.7(in)]TJ /F12 1 Tf 17.6404 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(ma)19.7(ti)18.9(on)-379.3(\()]TJ 0 0 0 0.7 k 4.7562 0 TD (15)Tj 0 0 0 1 k 0.9369 0 TD [(\).)-381.9(In)]TJ -23.8527 -1.2114 TD [(ad)20.1(di)22.1(ti)18.9(on)20.5(,)-331(M)0(2)21.3(-)0(t)17.5(y)0(p)23.2(e)-330(m)12.3(a)0(c)17.5(r)11.9(op)17.4(h)11.8(a)0(g)17.7(e)0(s)-318.1(h)11.8(av)17.8(e)-330(b)0(e)20.8(e)0(n)-320.1(r)11.9(ep)17(or)22.6(te)19.8(d)-327.4(t)0(o)-319.9(a)0(t)22.9(t)0(e)19.8(n)0(u)16.7(a)13.3(te)]TJ T* [(experi)9.2(mentally)-436.9(induced)-441.3(in)]TJ /F12 1 Tf 10.7716 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ammati)10.5(on)-445(in)-446.2(the)-445.8(gut)-444.7(\()]TJ 0 0 0 0.7 k 9.5423 0 TD (16)Tj 0 0 0 1 k 0.9548 0 TD [(\).)-447.5(Passiv)10.2(e)]TJ -21.7998 -1.2055 TD [(tr)21.5(an)17.2(s)11.9(f)0(e)20.7(r)-429.7(of)]TJ /F14 1 Tf 4.6428 0 TD [(in)-422.4(v)13.3(i)0(t)17(r)11.9(o)]TJ /F11 1 Tf 3.4493 0 TD [(de)17(r)11.9(i)0(v)19.8(e)0(d)-418.7(a)13.3(lt)20.9(er)16.1(na)23.2(ti)18.9(ve)20.6(ly)-419.9(a)13.3(c)0(t)19.8(i)0(v)19.8(a)13.3(te)19.8(d)-428.9(m)0(a)19.7(c)0(r)16.1(o)0(p)23.4(h)11.8(ag)17.8(es)]TJ -8.0921 -1.2114 TD 0.0259 Tc [(conferred)-474.6(s)2(igni)]TJ /F12 1 Tf 6.5465 0 TD 0 Tc ()Tj /F11 1 Tf 0.555 0 TD 0.0259 Tc [(cantly)-476.9(reduced)-474.6(coloni)5.4(c)-477.1(i)-0.5(n)]TJ /F12 1 Tf 11.255 0 TD 0 Tc ()Tj /F11 1 Tf 0.555 0 TD 0.0267 Tc [(amma)4.2(tion)-470.7(\()]TJ 0 0 0 0.7 k 5.1501 0 TD 0.0283 Tc (16)Tj 0 0 0 1 k 1.0085 0 TD 0.027 Tc (\).)Tj -25.0701 -1.2114 TD 0.0352 Tc [(He)3.6(l)4.7(m)-0.2(in)3.3(th-m)5.8(od)6.2(ul)4.7(ate)3.6(d)-483.2(ma)6.7(cr)5.3(op)6.2(ha)6.7(ge)3.6(s)-484(h)5.2(av)3.9(e)-479.8(b)4.1(ee)3.6(n)-480.1(e)3.6(xpl)4.7(o)-1.9(r)5.3(e)-2.3(d)-477.2(a)0.8(s)]TJ T* 0 Tc [(pr)18.7(om)23(is)21.3(in)19.2(g)-234.2(t)15.6(he)16(r)11.9(a)0(p)20.1(e)0(u)17(t)0(i)24.9(c)-234.5(fo)21.2(r)-226.8(i)0(n)]TJ /F12 1 Tf 10.9865 0 TD ()Tj /F11 1 Tf 0.5192 0 TD [(am)19.7(ma)19.7(to)20.2(ry)-222.3(d)12.7(i)0(s)15.3(e)0(a)23.5(s)11.9(e)-234.5(\()]TJ 0 0 0 0.7 k 7.567 0 TD (8)Tj 0 0 0 1 k 0.4655 0 TD (,)Tj 0 0 0 0.7 k 0.4476 0 TD (16)Tj /F13 1 Tf 0 0 0 1 k 0.9369 0 TD (?Tj /F11 1 Tf 0 0 0 0.7 k 0.5013 0 TD (18)Tj 0 0 0 1 k 0.9369 0 TD (\).)Tj -21.0957 -1.2114 TD [(Th)23.1(e)-204.6(p)0(r)18.7(o)0(g)21.1(r)0(a)19.2(m)0(m)18.7(e)0(d)-197.9(c)0(e)20.4(l)0(l)-192.3(d)0(e)17(a)0(t)22.9(h)0(-)19.7(1)-207.3(\(P)21.8(D-)20.8(1\))-198.5(is)-199.5(a)-201.5(m)0(e)16.6(m)12.3(be)20.8(r)-208.9(o)0(f)-193.7(t)0(h)21.4(e)-210.6(CD)24.4(28)]TJ -1.2651 -1.2114 TD [(s)11.9(u)0(p)19.5(e)0(r)16.1(f)0(a)23.8(m)0(i)15.7(l)0(y)-211(t)0(h)21.4(a)0(t)-215.8(d)12.7(el)21.5(iv)19.8(er)16.1(s)-220.8(n)0(e)20.1(g)0(a)17.7(t)15.6(iv)19.8(e)-222.5(s)0(i)15.3(g)0(n)20.3(a)13.3(ls)-215.5(u)12.7(p)0(o)17.4(n)-222.9(in)19.2(te)19.8(r)11.9(a)0(c)17.5(t)0(i)24.9(o)0(n)-218.2(w)14.6(it)18.9(h)-220.9(i)0(t)18.9(s)]TJ 9.5 0 0 9.5 306.1417 615.6282 Tm [(tw)24.2(o)-281.8(l)0(i)20.6(g)0(a)17.7(n)0(d)22.6(s)11.9(,)-283.3(P)13(D-)20.8(L1)-273(a)13.3(n)0(d)-269.8(P)0(D)19.9(-)0(L)19.7(2)0(.)-269.8(E)0(x)21.5(p)0(r)18.7(e)0(s)16.1(s)11.9(io)20(n)-276.6(o)0(f)-271.2(P)0(D)19.9(-)0(1)-271(o)0(n)-265.9(T)-281.2(ce)20.4(ll)22.6(s,)-271.4(B)]TJ T* [(ce)20.4(ll)22.6(s,)-193.8(m)12.3(a)0(c)17.5(r)11.9(op)17.4(h)11.8(a)13.3(ge)14.7(s)11.9(,)-199.7(an)17.2(d)-202.1(d)12.7(en)20.1(dr)18.7(it)18.9(ic)-189.3(ce)20.4(ll)22.6(s)-202.9(\()0(D)21.7(C)0(s)17.4(\))-200.1(is)-187.6(in)19.2(du)19.5(ci)19.6(bl)21.9(e)-204.6(\()]TJ 0 0 0 0.7 k 22.4324 0 TD -0.0135 Tc (19)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc [(\))14.8(.)-205.7(Th)23.1(e)]TJ -23.3693 -1.2114 TD [(PD)-10(-)-10(1)-463.9(pa)-9.8(t)-8.3(h)0(w)-9.4(a)-10.6(y)-461(i)-8.5(s)-459.5(v)-7.5(i)-8.5(t)-8.3(al)-464.8(f)-7.4(o)-7.3(r)-465.5(p)0(h)-11.2(y)-7.5(si)-14.5(ol)-7.9(o)-7.2(g)-7.5(i)-8.5(c)-461.2(re)-13.7(g)-7.5(u)0(l)-11.8(a)0(t)-12.9(i)-8.5(o)-7.2(n)-461.6(o)-7.3(f)-460.9(i)-8.5(m)0(m)-11.1(u)0(n)-13.2(e)]TJ 0 -1.2055 TD [(r)11.9(e)0(s)16.1(p)12.8(on)20.5(se)16.1(s)-292.4(t)0(o)-284.1(a)13.3(vo)15.1(i)15.3(d)-297.6(in)19.2(ju)24(ri)15.3(ou)23.4(s)-298.4(o)0(v)21.1(e)0(r)22.1(a)0(c)17.5(t)0(i)24.9(v)0(e)-289.7(i)15.3(n)]TJ /F12 1 Tf 16.3812 0 TD ()Tj /F11 1 Tf 0.5252 0 TD -0.0133 Tc [(am)-13.3(m)5.4(a)-13.3(t)9.6(i)-13.3(o)6.7(n)-307.8(\()]TJ 0 0 0 0.7 k 4.6548 0 TD 0 Tc (20)Tj 0 0 0 1 k 0.9369 0 TD (,)Tj 0 0 0 0.7 k 0.5132 0 TD (21)Tj 0 0 0 1 k 0.9369 0 TD [(\).)-286.4(In)]TJ -23.9482 -1.2114 TD [(a)13.3(d)0(d)19.5(i)0(t)18.9(i)0(o)20(n)0(,)-195.8(P)13(D-)20.8(1)-201.3(s)0(e)16.1(r)11.9(ve)20.6(s)-202.9(a)0(s)-195.6(a)13.3(n)-205(i)0(m)21.7(p)0(o)17.4(r)11.9(ta)16.9(nt)-189.4(im)21.7(mu)19.1(ne)-194.8(ch)22(ec)14.4(k)11.6(p)12.7(oi)20(nt)-195.4(to)-188.6(ke)15.8(ep)]TJ T* [(im)21.7(mu)19.1(ne)-391.7(ba)23.9(la)18.6(nc)20.1(e)-401.6(a)13.3(nd)-395.1(p)12.8(r)11.9(ev)20.6(en)14.1(t)-396.2(a)0(u)20.1(t)0(o)20.2(i)0(m)21.7(m)0(u)19.1(n)0(i)19.2(t)0(y)-391.8(\()]TJ 0 0 0 0.7 k 18.6251 0 TD (21)Tj /F13 1 Tf 0 0 0 1 k 0.9369 0 TD (?Tj /F11 1 Tf 0 0 0 0.7 k 0.5013 0 TD (23)Tj 0 0 0 1 k 0.9369 0 TD [(\).)-393.8(A)12.7(l)0(t)20.9(h)11.8(ou)17.4(gh)]TJ -21.0002 -1.2114 TD [(m)12.3(a)0(n)17.2(y)-276(s)11.9(t)0(u)16.4(d)12.8(ie)19.6(s)-280.5(h)11.8(a)13.3(v)0(e)-271.8(s)11.9(h)11.8(o)0(w)19.3(n)-276.6(th)21.4(e)-276.2(i)0(m)15.7(p)12.8(or)22.6(ta)16.9(nc)20.1(e)-276.2(o)0(f)-265.3(P)0(D)19.9(-)0(1)-265(i)0(n)-267.2(m)0(o)17(d)12.8(ul)18.1(a)13.3(t)0(i)18.9(n)0(g)]TJ T* [(th)21.4(e)-258.3(T)-263.2(ce)20.4(ll)-246(fu)17.3(nc)20.1(ti)18.9(on)20.5(,)-259.4(s)11.9(om)17(e)-258.3(e)0(v)20.6(i)0(d)22.1(e)0(n)20.1(c)0(e)-254.1(h)11.8(as)-249.3(em)16.6(er)22.1(ge)20.6(d)-261.8(t)0(h)21.4(a)0(t)-251.6(P)13(D-)20.8(1)-261(p)12.8(la)18.6(ys)-252.2(a)]TJ T* [(d)12.7(i)0(s)15.3(t)15.6(in)19.2(ct)-218.9(ro)16.6(le)-217.2(in)-219.5(t)15.5(h)0(e)-222.7(r)11.9(eg)20.6(ul)18.1(a)13.3(t)0(i)18.9(o)0(n)-218.2(o)0(f)-217.5(m)0(a)19.7(c)0(r)16.1(o)0(p)23.4(h)11.8(ag)17.8(e)-228.5(p)12.7(ol)16(a)13.3(r)11.9(iz)19.6(at)16.9(io)20(n)-228.8(\()]TJ 0 0 0 0.7 k 22.7905 0 TD -0.0135 Tc (24)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc (,)Tj 0 0 0 0.7 k 0.4416 0 TD (25)Tj 0 0 0 1 k 0.9429 0 TD -0.0148 Tc (\).)Tj -25.1119 -1.2114 TD 0.0241 Tc [(Expression)-473.3(of)-472.6(PD-1)-475.6(was)-477.2(r)0.2(eported)-476.4(t)3.8(o)-472.5(p)-4.9(ro)4.9(mote)-473(macrophage)]TJ 0 -1.2055 TD 0.0442 Tc [(polarization)-494.9(toward)-492.1(M2)-491.3(phenoty)-5.1(p)3.2(e)-494.6(a)-2.2(nd)-492.1(PD-1)-497.3(de)]TJ /F12 1 Tf 22.3548 0 TD 0 Tc ()Tj /F11 1 Tf 0.5789 0 TD 0.0437 Tc (ciency)Tj -22.9337 -1.2114 TD 0 Tc [(en)20.1(h)11.8(a)0(n)17.2(c)0(e)20.4(d)-231.9(M)13.7(1)-231.2(p)12.7(o)0(l)16(a)13.3(ri)21.3(za)17.5(ti)18.9(on)-218.2(\()]TJ 0 0 0 0.7 k 10.8015 0 TD -0.0135 Tc (26)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc (,)Tj 0 0 0 0.7 k 0.4476 0 TD -0.0135 Tc (27)Tj 0 0 0 1 k 0.9369 0 TD 0 Tc (\).)Tj -11.8577 -1.2114 TD [(In)-337.4(recent)-337.9(years,)-344.9(many)-336(studies)-345.3(have)-336.2(indicated)-344.2(that)-337.7(helminths)]TJ -1.2651 -1.2114 TD [(induce)-346.6(PD-1)-346.6(pathway)-343.9(to)-349.8(modulate)-342.8(the)-350.3(host)-344(immune)-344.9(system)-351.4(to)]TJ T* 0.0188 Tc [(mi)4.3(ni)4.3(mize)-514.1(exce)5.1(ssiv)5.4(e)-520(i)4.3(n)]TJ /F12 1 Tf 9.5244 0 TD 0 Tc ()Tj /F11 1 Tf 0.5431 0 TD 0.0167 Tc [(a)-5.8(mmation)-522.4(against)-516.8(i)2.2(nvad)-6.4(ed)-519.6(parasites)]TJ -10.0674 -1.2114 TD 0 Tc [(facilitat)-10.9(ing)-501.5(worms)]TJ /F13 1 Tf 7.4476 0 TD (?Tj /F11 1 Tf 0.7221 0 TD [(survival)-505.4(and)-507.1(promoting)-505.2(the)-505.5(chronic)-9.5(ity)-501.8(of)]TJ -8.1697 -1.2055 TD [(helminth)-492.6(infection)-495.2(\()]TJ 0 0 0 0.7 k 8.5039 0 TD (28)Tj 0 0 0 1 k 0.9548 0 TD (\).)Tj /F14 1 Tf 1.0563 0 TD [(Trichinella)-493.2(spiralis)]TJ /F11 1 Tf 7.5491 0 TD [(,)-492.2(a)-493.9(tissue-dwelling)]TJ -18.0641 -1.2114 TD [(intestinal)-212(nematode,)-212.3(is)-205.5(known)-212(to)-206.5(secrete)-212.3(molecules)-209.5(that)-212.3(modulate)]TJ T* [(the)-320.5(host)-326(immune)-327(system)-321.6(\()]TJ 0 0 0 0.7 k 10.6642 0 TD (29)Tj 0 0 0 1 k 0.9608 0 TD [(\).)-322.2(Infection)-326.7(with)-318.7(this)-327.3(nematode,)-325.7(or)]TJ -11.625 -1.2114 TD [(treatment)-225.7(with)]TJ /F14 1 Tf 6.1168 0 TD (Trichinella)Tj /F11 1 Tf 4.2788 0 TD [(-derived)-230.8(proteins,)-226.9(has)-231.5(been)-221.7(extensively)]TJ -10.3957 -1.2114 TD [(investigated)-237.1(for)-229.5(the)-236.9(treatment)-231.7(of)-235.4(many)-234.6(hypersensitivity)-236.7(disorders)]TJ T* (\()Tj 0 0 0 0.7 k 0.3461 0 TD (7)Tj 0 0 0 1 k 0.4774 0 TD (,)Tj 0 0 0 0.7 k 0.6684 0 TD (30)Tj 0 0 0 1 k 0.9608 0 TD (,)Tj 0 0 0 0.7 k 0.6684 0 TD (31)Tj 0 0 0 1 k 0.9608 0 TD [(\).)-453.5(Our)-453.8(previous)-459.1(study)-455.8(demonstrated)-455.8(that)-451(excretory/)]TJ -4.0819 -1.2055 TD 0.0191 Tc [(secretory)-519.5(p)-4(roduct)4.8(s)-524(f)-0.2(rom)]TJ /F14 1 Tf 11.0342 0 TD 0.0214 Tc [(T.)-513.5(spi)5(r)3.5(alis)]TJ /F11 1 Tf 4.8278 0 TD 0.0213 Tc [(ad)4.2(ult)-518.1(w)6(orms)-515.8(\()]TJ /F14 1 Tf 6.3436 0 TD 0.0157 Tc (Ts)Tj /F11 1 Tf 0.9608 0 TD 0.0212 Tc [(-AES)5.8(\))]TJ -23.1664 -1.2114 TD 0.049 Tc [(ameliorated)-547(D)2.2(SS-in)5.2(d)-3.9(uced)-546.9(coli)4.7(tis)-547.8(i)4.6(n)-549.8(m)1.7(ice)]TJ /F14 1 Tf 19.4188 0 TD 0.0523 Tc [(vi)6(a)]TJ /F11 1 Tf 1.8918 0 TD 0.0495 Tc [(inhi)5.1(biti)5.1(ng)]TJ -21.3105 -1.2114 TD 0 Tc (proin)Tj /F12 1 Tf 2.1842 0 TD ()Tj /F11 1 Tf 0.5371 0 TD [(ammatory)-312(cytokines)-312(\(IFN-)]TJ /F8 1 Tf 10.7836 0 TD (g)Tj /F11 1 Tf 0.4058 0 TD [(,)-313.1(IL-6,)-310.9(IL-17\))-315.7(\()]TJ 0 0 0 0.7 k 5.9319 0 TD (5)Tj 0 0 0 1 k 0.4834 0 TD [(\).)-310.3(It)-307.9(has)-315.1(been)]TJ -20.3258 -1.2114 TD [(reported)-387.5(that)-385.4(adoptive)-382.4(transfer)-388.2(of)-384.6(macrophages)-390.4(obtained)-385.1(from)]TJ T* 0.0198 Tc [(helminth-inf)-5.5(ected)-522.4(mice)-525(an)-6.1(d)-516.5(h)-4.2(elminth)-517.4(E)-3(S)-520.7(p)2.7(rotein-ac)-5.8(t)-0.5(ivate)-5.8(d)]TJ T* 0 Tc [(macrophages)-408.3(reduced)-402.6(allergic)-407.4(asthma)-405.2(and)-405.7(DSS-induced)-409.6(colitis)]TJ T* [(in)-398.5(mice)-405.5(\()]TJ 0 0 0 0.7 k 3.8551 0 TD (16)Tj 0 0 0 1 k 0.9548 0 TD [(\).)-399.8(However,)-404.2(the)-404(signal)-405.3(pathway\(s\))-403.9(and)-399.7(mechanism)]TJ -4.8099 -1.2055 TD [(inv)-12.1(olv)-9.4(ed)-508.2(in)-511.9(th)-8.4(e)-503(M)0(2)-509.9(m)0(a)-10.2(c)0(r)-7.7(opha)-11.2(ge)-510.5(pol)-13.1(ariz)-14.9(at)-7(ion)-513.2(ind)-9.8(uce)-8.6(d)-506.4(b)-7.3(y)]TJ /F14 1 Tf 24.8314 0 TD (T.)Tj -24.8314 -1.2114 TD (spiralis)Tj /F11 1 Tf 3.1867 0 TD [(AES)-407.5(are)-406.2(still)-406.1(unknown.)-413(Here,)-410(we)-404.9(characterize)-410.9(the)-404(role)]TJ -3.1867 -1.2114 TD (of)Tj /F14 1 Tf 1.0622 0 TD [(T.)-270.1(spiralis)]TJ /F11 1 Tf 4.1416 0 TD [(AES)-270.2(in)-267.2(the)-272.8(M2)-271.1(macrophage)-271(polarization)-273.6(associated)]TJ -5.2038 -1.2114 TD [(with)-294.8(the)-302.6(therapeutic)-302.1(ef)]TJ /F12 1 Tf 9.047 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(cacy)-296(of)-301.1(DSS-induced)-302.1(colitis)-297.7(in)-303(mice)-298.1(and)]TJ -9.5781 -1.2114 TD [(the)-326.5(involvement)-327.4(of)-330.9(PD-1)-322.8(in)-326.9(the)-326.5(activation)-330(of)-330.9(M2)-324.9(macrophages.)]TJ T* [(This)-224.2(study)-229(highlights)-226.4(the)-225(importance)-230(of)-223.5(PD-1)-227.3(as)-225.4(a)-225.4(checkpoint)-228(for)]TJ 0 -1.2055 TD [(AES-induced)-387.4(M2)-384.5(macrophage)-390.4(polarization)-387(associated)-388.2(with)-384.3(the)]TJ 0 -1.2114 TD [(protective)-390.5(ef)62.5(fects)-389.2(of)-384.6(AES)-383.6(on)-385.3(DSS-induced)-391.7(colitis.)-390(Our)]TJ /F12 1 Tf 22.4444 0 TD ()Tj /F11 1 Tf 0.5311 0 TD (ndings)Tj -22.9755 -1.2114 TD 0.0436 Tc [(provide)-543(n)-0.2(ew)-538.6(insi)5.2(ghts)-541.3(int)5.4(o)-542.5(the)-537(m)-3.7(ec)6.1(hani)5.2(sms)-541.3(o)0.5(f)-536.7(h)-4.3(e)6.1(l)1.2(mi)5.2(nth)]TJ T* 0.03 Tc [(immu)-5(nom)-5.4(o)-1.1(dulation)-533(o)-1.1(f)-532.4(t)3.8(he)-532.7(hos)-5.8(t)-527.3(immu)-5(ne)-526.7(s)-5.8(y)-1.3(stem)-536.5(and)-530.1(t)-2.2(he)]TJ T* 0 Tc [(pot)-8.8(e)-7.7(ntia)-11.6(l)-507.9(t)0(h)-8.4(e)0(r)-7.7(a)0(p)-9.8(eut)-9.2(ic)-511.6(e)-7.7(f)58.3(fec)-10.9(t)-503.6(o)-7.2(f)-508.7(nem)-9.4(at)-7(ode)-14.1(-de)-11(ri)-8.6(ved)-515.7(pro)-12.4(tein)-14.7(s)-507.3(o)0(n)]TJ T* (in)Tj /F12 1 Tf 0.7997 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ammatory)-306(bowel)-300.7(diseases.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 306.1417 122.0598 Tm [(MATERIALS)-301.3(AND)-301.7(METHODS)]TJ 0 -1.748 TD (Animals)Tj /F11 1 Tf 9.5 0 0 9.5 306.1417 89.5748 Tm [(Wild-type)-451.6(\(WT\))-447.3(and)-447.5(PD-1)-442.1(knockout)-450.2(mice)-447.3(\(KO)-448.1(mice\))-444.4(of)-450.3(the)]TJ 0 -1.2114 TD [(C57BL/6)-290.3(strain)-298.1(were)-293.3(purchased)-292.3(from)-294.7(Jackson)-296.8(Laboratory)-291.6(\(stock)]TJ T* [(no.)-388.1(021157,)-387.2(USA\).)-389.7(Female)-389.5(ICR)-384.2(mice)-387.6(aged)-389(6)]TJ /F13 1 Tf 18.1775 0 TD (?Tj /F11 1 Tf 0.5132 0 TD [(8)-386.3(weeks)-389.1(and)-387.8(rats)]TJ ET q 45.354 114.066 m 289.134 114.066 l 289.134 66.557 l 45.354 66.557 l W n 0 0 0 rg 45.354 114.066 m 117.354 114.066 l 117.354 113.613 l 45.354 113.613 l 45.128 113.726 l 45.128 113.953 l f* Q BT /F15 1 Tf 7.4999 0 0 7.4999 45.3543 104.5417 Tm (Abbreviations:)Tj /F11 1 Tf 6.5613 0 TD [(IBD,)-435(in)]TJ /F12 1 Tf 3.0993 0 TD ()Tj /F11 1 Tf 0.5291 0 TD [(ammatory)-436.1(bowel)-438.7(disease;)-436.8(CloA,)-432.9(liposomal)-438.3(clodronate,)]TJ -10.1897 -1.2624 TD [(Clophosome)-249.9(-A;)-252.8(PD-1,)-250.8(programmed)-254.6(death)-250.7(1;)-247.9(WT,)-248.5(wild)-250.8(type;)-247.9(KO,)-251.7(knockout;)-258.1(DAI,)]TJ 0 -1.2699 TD [(disease)-269.3(activity)-274.3(index;)-268(MPO,)-271.9(myeloperoxidase;)-277.2(DSS,)-271.3(dextran)-270.4(sulfate)-269.8(sodium;)-275.6(AES,)]TJ T* [(excretory/secretory)-333.7(products)-326.4(from)]TJ /F14 1 Tf 14.0827 0 TD [(Trichinella)-328.5(spiralis)]TJ /F11 1 Tf 7.7103 0 TD [(adult)-329.4(worms;)-323(FVD,)]TJ /F12 1 Tf 8.111 0 TD ()Tj /F11 1 Tf 0.5291 0 TD (xable)Tj -30.4331 -1.2624 TD [(viability)-299.7(dye.)]TJ ET 0 0 0 0.7 k 45.354 737.518 504.567 0.28345 re f BT /F6 1 Tf 6.9999 0 0 6.9999 45.3543 744.2644 Tm [(Wang)-303.4(et)-300.5(al.)]TJ /F4 1 Tf 56.9126 0 TD [(Trichinella)-298.7(spiralis)]TJ /F6 1 Tf 7.6537 0 TD [(Attenuated)-302.9(Colitis)]TJ ET 45.354 42.803 504.567 0.22675 re f 45.354 42.803 504.567 0.22675 re f BT 6.9999 0 0 6.9999 45.3543 31.2945 Tm [(Frontiers)-306.1(in)-296.3(Immunology)-503.1(|)-502.8(www.frontiersin.org)]TJ 52.8468 0 TD [(October)-304.5(2020)-505.2(|)-494.7(Volume)-307.7(11)-499.6(|)-494.7(Article)-305.6(563784)]TJ -17.0811 0 TD (2)Tj ET endstream endobj 42 0 obj<> endobj 43 0 obj<> endobj 44 0 obj<> endobj 45 0 obj<> endobj 46 0 obj<> endobj 47 0 obj<> endobj 48 0 obj<> endobj 49 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 50 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 51 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 52 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 53 0 obj<>/ProcSet[/PDF/Text]/ExtGState<>>> endobj 54 0 obj<>stream /GS1 gs BT /F11 1 Tf 9.5 0 0 9.5 45.3543 710.4754 Tm 0 0 0 1 k 0 Tc 0 Tw [(were)-269.4(purchased)-274.4(from)-264.9(the)-272.8(Capital)-265.1(Medical)-271.3(University)-270.1(Laboratory)]TJ 0 -1.2114 TD [(Animal)-325.1(Services)-329.1(Center)-324.6(\(Beijing,)-329.2(China\).)-326.1(All)-328.8(animals)-324.5(were)-323.1(kept)]TJ T* [(in)-303(a)-297(pathogen-free)-308.3(environment.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 45.3543 664.951 Tm [(Preparation)-303.4(of)-302.4(Excretory/Secretory)-313.7(\(ES\))]TJ 0 -1.0394 TD [(Products)-304.2(From)-301.5(Adults)]TJ /F14 1 Tf 9.5 0 0 9.5 45.3543 640.9699 Tm [(T.)-323.8(spiralis)]TJ /F11 1 Tf 4.249 0 TD [(\(strain)-325.1(ISS)-324.4(533\))-326.6(was)-318.3(maintained)-331.7(in)-320.9(female)-326(ICR)-324.6(mice.)]TJ -4.249 -1.2114 TD 0.0247 Tc [(The)-520.1(m)1.2(usc)5.1(l)0.2(e)-520.1(l)0.2(arvae)-520.1(w)3.5(ere)-520.1(r)0.8(e)5.1(c)-0.9(ov)5.3(ere)5.1(d)-523.5(fro)5.5(m)-523.9(i)4.2(n)-1.2(f)5.4(ect)4.4(ed)-517.5(mic)5.1(e)-520.1(by)]TJ T* 0 Tc [(digestion)-496.7(of)-498(the)-493.6(carcasses)-503.9(in)-494(arti)]TJ /F12 1 Tf 13.8927 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(cial)-492.9(gastric)-496.2(juice)-501.2(\()]TJ 0 0 0 0.7 k 7.6565 0 TD (32)Tj 0 0 0 1 k 0.9608 0 TD [(\).)-495.3(The)]TJ -23.0411 -1.2114 TD [(recovered)-492.4(muscle)-498.3(larvae)-490.5(were)-490.2(used)-495.5(to)-487(infect)-495.3(rats)-490.4(orally)-492.1(with)]TJ T* 0.0218 Tc [(14,000)-519.7(larvae)-523(each.)-524.1(S)0.5(ix)-524.7(days)-521.3(af)]TJ 13.8808 0 TD 0.0209 Tc [(ter)-522.2(i)-5.5(nfec)-4.7(tion)-5(,)-525(e)1.3(ach)-522.3(r)-3(at)-524.5(was)]TJ -13.8808 -1.2055 TD 0.0102 Tc [(e)-3.5(u)-0.9(than)-3.8(iz)-3.5(ed,)-511.8(a)-0.4(n)-3.8(d)-514.1(the)-510.7(a)-0.4(dult)]TJ /F14 1 Tf 11.6429 0 TD 0.0112 Tc [(T.)-511.7(spiral)11.2(i)-10.9(s)]TJ /F11 1 Tf 4.7324 0 TD 0.0128 Tc [(worms)-506.4(w)3.5(ere)-508.1(c)5.1(oll)6.2(ect)4.5(ed)]TJ -16.3752 -1.2114 TD 0 Tc [(from)-342.5(intestine.)-348.5(The)-342.7(collected)-345.3(adult)-346.1(worms)-338.5(were)-347(washed)-343.2(several)]TJ T* [(times)-239(with)-235.1(sterile)-235.9(saline)-238.4(\(0.9%)-231.5(NaCl\))-236.6(and)-238.6(cultured)-236.8(in)-237.4(RPMI-1640)]TJ T* [(\()-9.1(T)-6.6(he)-13.8(r)-12(m)0(o)-520.1(F)0(i)-13.7(s)0(h)-18.1(e)-7.7(r,)-522(C)-6.4(a)0(r)-16.6(l)-6.6(sb)-13.2(a)-10.6(d)0(,)-521.2(U)0(S)-14.4(A)-11.2(\))-510.4(s)-12(up)-16.3(pl)-11.8(e)-7.7(m)0(e)-19.2(n)0(t)-10.4(e)-7.7(d)-518.4(w)0(i)-11.9(t)-8.3(h)-513.3(2)-10.3(00)-522(U)]TJ T* 0.0328 Tc [(penicillin/ml)-528.8(and)-527.3(200)]TJ /F8 1 Tf 10.2345 0 TD 0 Tc (m)Tj /F11 1 Tf 0.6027 0 TD 0.0313 Tc [(g)-537.1(s)1.4(treptomyc)-6.2(i)4.9(n)-6.6(/)1.2(ml)-536.3(\()4.3(C)-4.9(aisson)-531.7(labs,)]TJ -10.8373 -1.2114 TD 0 Tc [(Logan,)-460(USA\))-458.5(at)-454.5(3000)-453.2(worms/ml)-458.3(at)-460.5(37C,)-454.8(5%)-453.9(CO)]TJ 7.1249 0 0 6.3326 243.4393 524.3527 Tm (2)Tj 9.5 0 0 9.5 246.8409 525.94 Tm [(,)-456.3(for)-456.3(48)-456.3(h.)]TJ -21.209 -1.2055 TD 0.0254 Tc [(Cultured)-528.8(medium)-523.2(containi)4.9(ng)-525.1(AES)-527.1(p)-3.6(roducts)-523.7(w)-1.8(as)-523.7(c)-6.2(o)0.2(llected)]TJ 0 -1.2114 TD 0 Tc [(and)-405.7(concentrated)-414.8(buf)63.8(fer-exchanged)-411.3(to)-409.4(PBS)-404.1(using)-411.2(a)-404.4(centrifugal)]TJ /F12 1 Tf T* ()Tj /F11 1 Tf 0.5311 0 TD [(lter)-500.1(\(Millipore)-499.4(Amicon)-501.9(Ultra-15,)-499.7(NMWL:)-502.2(3000,)-497.7(USA\),)-503(and)]TJ -0.5311 -1.2114 TD [(buf)63.8(fer-exchanged)-506.8(to)-499(PBS)-499.6(\()]TJ 0 0 0 0.7 k 11.1416 0 TD (32)Tj 0 0 0 1 k 0.9548 0 TD [(\).)-501.2(Protein)-498.4(concentration)-503.3(in)-500(AES)]TJ -12.0964 -1.2114 TD 0.0546 Tc [(was)-554.1(d)-4.3(etermined)-553.3(u)-4.3(sing)-555.6(th)-5.2(e)-555.8(B)5(C)-5.5(A)-553.4(pr)-5.1(otein)-556.2(a)-3.7(ssay)-549.6(\()-2.2(Merck,)]TJ T* 0 Tc [(Darmstadt,)-307.1(Germany\).)]TJ /F1 1 Tf 11.9999 0 0 11.9999 45.3543 434.4377 Tm [(Development)-304.1(of)-302.4(a)-302(DSS-Induced)-304.1(Colitis)]TJ 0 -1.0394 TD [(Mouse)-300.1(Model)]TJ /F11 1 Tf 9.5 0 0 9.5 45.3543 410.4566 Tm [(To)-455.5(develop)-458.8(a)-458.1(colitis)-458.8(mouse)-461.4(model,)-458.8(male)-460.1(C57BL/6)-457.4(mice)-459.2(were)]TJ 0 -1.2114 TD [(exposed)-263.2(to)-260.2(2.5%)-258.2(dextran)-264.1(sodium)-258.5(sulfate)-260.6(polymers)-266.6(\(DSS,)-256.6(36,000)]TJ /F13 1 Tf 25.1537 0 TD (?Tj /F11 1 Tf -25.1537 -1.2114 TD [(50,000)-245.5(MW,)-244.5(MP)-241.9(Biomedicals,)-245.4(Solon,)-250.2(USA\))-243.6(in)-243.3(drinking)-243.1(water)-244.8(for)]TJ 0 -1.2055 TD [(7)-416.1(days.)-413.9(Meanwhile,)-423.6(each)-414(mouse)-413.6(was)-419.7(injected)-417.8(intraperitoneally)]TJ 0 -1.2114 TD [(with)-247.1(20)]TJ /F8 1 Tf 3.2225 0 TD (m)Tj /F11 1 Tf 0.5729 0 TD [(g)-246.2(AES)-246.4(in)-243.3(a)-249.3(total)-244(volume)-248.6(of)-247.4(100)-245.9(l)-242.6(every)-251.2(day)-244(until)-251.5(day)-244(7,)]TJ -3.7954 -1.2114 TD [(when)-257.9(the)-260.8(mice)-262.3(were)-257.5(sacri)]TJ /F12 1 Tf 10.0734 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ced)-259.3(\()]TJ /F15 1 Tf 0 0 0 rg 1.9574 0 TD [(Figure)-259.9(1A)]TJ /F11 1 Tf 0 0 0 1 k 4.1595 0 TD [(\).)-262.5(The)-259.1(same)-262.6(volume)-254.6(of)]TJ -16.7214 -1.2114 TD [(PBS)-422(was)-419.7(administered)-421.5(to)-421.4(control)-421.2(mice.)-420.2(Animal)-420.5(body)-421(weights,)]TJ T* [(stool)-220.4(consistency)-220(\(diarrhea\),)-224.9(and)-220.7(presence)-223.1(of)-217.5(rectal)-225.9(bleeding)-219.6(were)]TJ T* [(monitored)-278.7(daily.)-279.9(All)-275.1(mice)-280.2(were)-275.4(sacri)]TJ /F12 1 Tf 14.5551 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ced)-277.2(on)-277.9(day)-273.9(7.)-275.7(Colons)-280.3(were)]TJ -15.0862 -1.2114 TD [(collected,)-264.5(and)-262.5(their)-263.4(length)-259.1(was)-258.6(measured)-268.7(from)-258.9(cecum)-266.6(to)-260.2(rectum.)]TJ 0 -1.2055 TD 0.0102 Tc [(The)-516.7(d)-0.9(i)-4.3(s)-1.8(e)-3.5(a)-0.4(s)-7.7(e)-510.7(a)-6.3(c)-3.5(ti)-4.3(v)-3.2(i)-4.3(ty)-516.5(i)-4.3(n)-3.8(de)-3.5(x)-512.4(\()-4.9(DA)-7(I\))-518.1(w)-5(a)-0.4(s)-515(s)-1.8(c)-3.5(o)-3(re)-3.5(d)-514.1(b)-3(as)-7.7(ed)-520.1(on)-511(t)-4.1(h)-1.9(e)]TJ 0 -1.2114 TD 0 Tc [(following)-343(parameters:)-350.9(stool)-345.8(consistency)-345.3(\(0)]TJ /F13 1 Tf 17.0794 0 TD (?Tj /F11 1 Tf 0.5132 0 TD [(4\),)-344.5(presence)-348.4(of)-277.2(fecal)]TJ -17.5926 -1.2114 TD 0.0132 Tc [(bl)-5.3(oo)-6(d)-517.1(\()-1.9(0)]TJ /F13 1 Tf 3.7178 0 TD 0 Tc (?Tj /F11 1 Tf 0.5311 0 TD 0.0165 Tc [(4\),)-517.4(a)5.9(nd)-513.8(per)4.5(c)-3.1(entage)-516.4(of)-516(body)-510.2(weight)-517(loss)-514.6(\(0)]TJ /F13 1 Tf 18.6967 0 TD 0 Tc (?Tj /F11 1 Tf 0.5252 0 TD 0.0164 Tc [(4\))-517.8(as)]TJ -23.4708 -1.2114 TD 0 Tc [(previously)-306.1(described)-305.9(\()]TJ 0 0 0 0.7 k 8.8381 0 TD (5)Tj 0 0 0 1 k 0.4834 0 TD (\).)Tj -8.0563 -1.2114 TD [(To)-252.6(evaluate)-255.1(the)-248.9(involvement)-255.8(of)-253.3(macrophages)-259.1(in)-255.3(DSS-induced)]TJ -1.2651 -1.2114 TD 0.0323 Tc [(co)-4.8(litis,)-531.5(lipo)-4.8(somal)-529.3(c)-5.2(lodronate)-536.4(w)-0.8(as)-534.7(use)-5.2(d)-533.8(to)-529.9(selectiv)-5(ely)-536.1(a)-2.1(nd)]TJ 0 -1.2055 TD 0 Tc (ef)Tj /F12 1 Tf 0.6445 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ciently)-364.7(deplete)-370.6(macrophages)-366.6(from)-366.4(treated)-364.1(mice)-363.7(\()]TJ 0 0 0 0.7 k 19.9081 0 TD (33)Tj 0 0 0 1 k 0.9548 0 TD [(\).)-364(In)-367.3(this)]TJ -22.0386 -1.2114 TD [(experiment,)-226.2(each)-223(mouse)-222.7(was)-216.8(injected)-226.9(intraperitoneally)-226.9(with)-217.2(1)-219.2(m)0(g)]TJ T* 0.0191 Tc [(of)-513.4(clo)5.9(p)2(hosome)5.4(-A)-511.3(\(Clo)5.9(A\),)-514.8(a)2.6(n)-520(a)2.6(n)5.1(i)]TJ 14.3821 0 TD 0.0181 Tc [(onic)-514.8(lipo)4.9(somal)-519.6(c)4.4(lodronate)]TJ -14.3821 -1.2114 TD 0 Tc [(\(FormuMax,)-441.2(Sunnyvale,)-443.3(USA\),)-443.4(in)-440.3(a)-440.2(volume)-439.6(of)-438.3(150)-436.9(l)-439.5(2)-440(days)]TJ T* [(prior)-301.5(to)-302(\(day)-300.8(-2\))-304(and)-298.3(4)-302.8(days)-303.7(after)-302.6(\(day)-300.8(4\))-299.9(DSS)-304.3(exposure.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 45.3543 157.9464 Tm [(Measurement)-308.1(of)-297.6(Myeloperoxidase)-309.5(Activity)]TJ /F11 1 Tf 9.5 0 0 9.5 45.3543 146.4377 Tm [(To)-306.3(measure)-305.3(the)-308.6(activity)-305.7(of)-301.1(myeloperoxidase)-317(\(MPO\),)-305.6(an)-305(enzyme)]TJ 0 -1.2055 TD [(pres)-12.9(ent)-507.4(nea)-8.4(rly)-503.5(e)-7.7(xclus)-11(ively)-509.3(in)-511.9(neutr)-11.3(ophi)-9.1(ls,)-504.8(an)-507.9(MPO)-511.4(assa)-9.3(y)-502.8(kit)]TJ 0 -1.2114 TD [(\(Nanjing)-363.7(Jiancheng)-362.8(Bio-engineering)-363.6(Institute,)-362.8(China\))-365(was)-360(used)]TJ T* [(according)-360.9(to)-361.7(the)-356.3(manufacturer)]TJ /F13 1 Tf 12.4724 0 TD (?Tj /F11 1 Tf 0.2208 0 TD [(s)-358.1(instructions.)-365.2(Brie)]TJ /F12 1 Tf 7.6625 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(y,)-362.4(50)-354.9(mg)-359.2(of)]TJ -20.8868 -1.2114 TD [(colon)-394.9(tissue)-399.8(was)-395.9(homogenized)-400.8(by)-396.7(ultrasonication)-403.4(in)-392.5(500)]TJ /F8 1 Tf 23.6498 0 TD (m)Tj /F11 1 Tf 0.5729 0 TD 0.3945 Tc [(lo)394.5(f)]TJ -24.2227 -1.2114 TD 0 Tc [(0.9%)-288(NaCl.)-290(Then,)-293.8(MPO)-290.6(activity)-287.8(was)-294.4(measured)-292.6(in)-285.1(25)-289.2(l)-290.3(of)-289.1(colon)]TJ T* [(tissue)-304.3(homogenate)-302.8(as)-303(U/g)-299.2(protein.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 306.1417 708.6046 Tm [(Histological)-303.5(Analysis)]TJ /F11 1 Tf 9.5 0 0 9.5 306.1417 697.0959 Tm [(Colonic)-344.2(tissue)-340.1(proximal)-345.6(to)-343.8(the)-338.4(rectum)-344.8(was)-342.1(collected)-345.3(from)-342.5(each)]TJ T* [(mo)-12.8(us)-11.2(e)-509(a)-10.6(nd)]TJ /F12 1 Tf 5.168 0 TD ()Tj /F11 1 Tf 0.5371 0 TD 0.0106 Tc [(xe)10.6(d)-503.5(i)2.1(n)-498.7(4)10.6(%)-508.9(p)10.6(ar)10.6(afor)10.6(ma)10.6(ld)10.6(eh)10.6(yd)10.6(e)]TJ /F12 1 Tf 12.8663 0 TD 0 Tc ()Tj /F11 1 Tf 0.5371 0 TD 0.0077 Tc [(xa)7.7(tion)-501.6(s)7.7(o)-5.6(lu)7.7(tion)7.7(.)]TJ -19.1084 -1.2055 TD 0.0385 Tc [(Se)-5(cti)-5.8(o)1.4(ns)-540.4(w)-6.6(e)1(re)-542.1(st)-5.6(aine)-5(d)-539.5(w)-0.6(it)-5.6(h)-540.5(h)]TJ 13.3974 0 TD 0.0403 Tc [(ematoxylin)-534.7(and)-537.7(e)2.8(osin.)-541.4(T)-2.1(he)]TJ -13.3974 -1.2114 TD 0 Tc [(histological)-323.7(damage)-327.5(score)-321.1(was)-324.2(calculated)-326.8(using)-327.6(two)-323.2(parameters:)]TJ T* [(epithelial)-296.7(damage)-291.7(\(0)]TJ /F13 1 Tf 8.1339 0 TD (?Tj /F11 1 Tf 0.5073 0 TD [(4\))-294(and)-292.3(in)]TJ /F12 1 Tf 3.7119 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ammatory)-294.1(cell)-291.2(in)]TJ /F12 1 Tf 6.8389 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ltration)-296.4(\(0)]TJ /F13 1 Tf 4.0759 0 TD (?Tj /F11 1 Tf 0.5073 0 TD (4\))Tj -24.8374 -1.2114 TD [(as)-303(described)-299.9(previously)-306.1(\()]TJ 0 0 0 0.7 k 9.9421 0 TD (5)Tj 0 0 0 1 k 0.4774 0 TD (\).)Tj /F1 1 Tf 11.9999 0 0 11.9999 306.1417 617.1022 Tm [(Peritoneal)-305.4(Macrophages)]TJ /F11 1 Tf 9.5 0 0 9.5 306.1417 605.5936 Tm [(Peritoneal)-302.4(macrophages)-306.9(were)-299.2(isolated)-304.8(from)-300.7(C57BL/6)-302.3(male)-305(mice)]TJ 0 -1.2114 TD [(\(WT\))-256.3(and)-262.5(PD-1)-251.1(KO)-260(mice)-256.3(by)-259.4(washing)-258.9(the)-254.8(peritoneal)-260.9(cavity)-259(twice)]TJ 0 -1.2055 TD [(with)-318.7(5)-314.7(m)0(l)-316.5(Hank)]TJ /F13 1 Tf 6.4928 0 TD (?Tj /F11 1 Tf 0.2148 0 TD [(s)-316.3(buf)57.8(fered)-320.4(salt)-318(solution)-319.7(\(HBSS)-320.1(without)-315.5(calcium)]TJ -6.7076 -1.2114 TD 0.0392 Tc [(and)-544.8(m)3.8(ag)-4.1(ne)-4.3(sium,)-536.5(G)-4.7(ibc)-4.3(o)2.1(,)-542.5(G)1.2(rand)-544.8(Island,)-542.5(U)4.3(S)-6(A)-1.9(\).)-536.5(H)-6.4(a)-1.2(rv)-4.1(este)-4.3(d)]TJ T* 0 Tc [(per)-12.9(ito)-12.2(ne)-9.8(al)-506.5(c)-7.7(e)0(l)-8.3(l)0(s)-507.9(w)-9.3(er)-7.7(e)-509(cul)-7.5(t)-8.3(ure)-12.9(d)-506.4(i)0(n)-511.9(6)0(-)-8.4(wel)-11.7(l)-507.9(tis)-10.9(su)-11.1(e)-503(c)-7.7(ult)-8.2(ur)-11.2(e)-509(pla)-10.4(te)-10.1(s)]TJ T* [(with)-312.7(2?0)]TJ 7.1249 0 0 6.3326 345.033 552.3589 Tm (6)Tj 9.5 0 0 9.5 351.4393 548.1069 Tm [(cells)-315.1(per)-317.2(well)-310.7(in)-314.9(RPMI-1640)-319(medium)-318.2(supplemented)]TJ -4.7682 -1.2114 TD [(with)-509.7(0.5%)-502.8(ina)-9.2(ctiv)-8.2(ated)-509.2(FBS,)-508.6(100)-502.5(U)-506.3(penici)-9.9(llin/)-12.1(ml)-501.5(and)-507.1(100)]TJ /F8 1 Tf 24.6285 0 TD (m)Tj /F11 1 Tf 0.5729 0 TD (g)Tj -25.2014 -1.2114 TD [(st)-8.3(re)-13.7(pt)-13.5(om)-6.9(y)-7.5(c)-7.7(in)-10.6(/m)-11.8(l)-6.6(;)-510.1(ce)-9.4(l)-6.6(l)-6.6(s)-507.3(w)-9.3(e)0(r)-7.7(e)-515(al)-11.2(lo)-7.9(we)-11(d)-512.4(t)0(o)-516.9(a)0(d)-9.8(h)0(e)-13.8(r)0(e)-515(f)-7.4(or)-514.5(4)-511.6(h)0(,)-516.2(a)0(n)-12.6(d)]TJ 0 -1.2055 TD [(nonadherent)-399.2(cells)-392.7(were)-388.8(removed.)-395.8(Adherent)-400.4(macrophages)-396.4(were)]TJ 0 -1.2114 TD [(collected)-303.5(directly)-302.2(for)]TJ /F12 1 Tf 8.5337 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ow)-297(cytometry)-304.5(or)-299.7(treated)-304.4(with)-300.8(AES)-300.1(\(4)]TJ /F8 1 Tf 15.2414 0 TD (m)Tj /F11 1 Tf 0.5729 0 TD (g/)Tj -24.8792 -1.2114 TD [(mL\))-229.6(for)-229.5(2)-225.2(h)-232.9(and)-226.7(then)-233(with)-229.2(either)-229.4(IL-4)-230.6(\(20)-226.7(ng/ml\))-228(or)-234.1(LPS)-229.3(\(100)-225.1(ng/)]TJ T* [(ml\))-277.9(\(PeproTech,)-280(Rocky)-280.1(Hill,)-279.1(NJ,)-278.6(USA\))-273.5(and)-280.4(10%)-279.2(inactivated)-276(FBS)]TJ T* [(for)-301.1(an)-299.1(additional)-305.5(6)-302.8(h)0(.)-301.3(Cells)-301.9(were)]TJ /F12 1 Tf 13.3079 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(nally)-301.9(collected)-303.5(for)-301.1(analysis.)]TJ -12.5738 -1.2114 TD 0.0421 Tc [(The)-538.5(R)-6.3(AW)-541.5(26)-4.1(4.7)-541.1(m)0.7(u)-4.8(r)0.3(ine)-544.5(m)0.7(a)-4.3(c)4.6(r)-5.7(o)5(p)-4.8(h)0.2(ages)-542.8(wer)-5.7(e)-538.5(obtained)]TJ -1.2651 -1.2114 TD 0 Tc [(from)-318.6(the)-314.5(Chinese)-313.1(National)-317.5(Infrastructure)-326.3(of)-313(Cell)-313.8(Line)-316.8(Resource)]TJ 0 -1.2055 TD [(\()-9.1(h)0(t)-8.4(t)-8.3(p:)-13.9(//)-12.4(c)-7.7(e)-7.7(l)-6.6(l)-6.6(r)0(e)-13.7(s)0(o)-13.2(u)0(r)-11.2(c)-7.7(e)-7.7(.)0(c)-10.5(n)-8(/c)-13.9(o)-7.3(n)-8(ta)-12.9(c)-7.7(t)0(.)-11.1(a)0(s)-10.6(p)-11.1(x,)-519.5(C)-6.4(h)0(i)-8.7(n)-8(a)-10.6(\))-510.4(an)-12.6(d)-512.4(c)-7.7(ul)-11.8(t)-8.3(u)0(r)-11.2(e)-7.7(d)-512.4(a)-10.6(n)-8(d)]TJ 0 -1.2114 TD 0.019 Tc [(analy)5.6(zed)-517.3(unde)5.3(r)-518.1(c)-0.6(o)5.8(n)-1(dit)4.7(i)-1.5(on)5(s)-518.1(i)4.5(de)5.3(nt)4.7(ical)-512.8(to)-513.4(tho)5.8(s)1.1(e)-519.8(o)5.8(f)-519.5(p)1.9(eri)4.5(t)-1.3(o)5.8(n)-1(eal)]TJ T* 0 Tc [(macrophage)-306.9(culturing.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 306.1417 387.6093 Tm [(RNA)-299.1(Extraction)-307.5(and)-300.9(qRT-PCR)]TJ /F11 1 Tf 9.5 0 0 9.5 306.1417 376.1007 Tm [(Total)-319.9(RNA)-317.2(was)-318.3(extracted)-321.5(from)-318.6(macrophages)-324.8(by)-313.1(TRIzol)-322.5(reagent)]TJ T* [(and)-387.8(quanti)]TJ /F12 1 Tf 4.4578 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ed)-388.8(by)-384.7(absorbance)-388.7(at)-382.9(260)-389.1(nm.)-386.4(A)-381.2(Fast)-388.1(King)-390.5(RT)-383.3(Kit)]TJ -4.989 -1.2055 TD [(\(TianGen,)-254.5(Beijing,)-248.5(China\))-251.6(was)-246.7(used)-250.8(to)-248.3(reverse-transcribe)-260.1(mRNA)]TJ 0 -1.2114 TD [(to)-367.7(cDNA.)-367.9(All)-364.6(qRT-PCR)-372.7(reactions)-368.5(were)-370.8(performed)-368.2(in)-368.7(triplicate)]TJ T* [(using)-267.9(the)-266.8(TransStart)-270.8(Top)-269.7(Green)-270.3(qPCR)-265.9(SuperMix)-270.4(kit)-267.9(\(TransGen,)]TJ T* 0.0339 Tc [(Be)-3.6(ijing,)-529.9(China\))-536.2(and)-538.2(Q)3.1(uan)-4(t)1.7(St)]TJ 12.9796 0 TD 0.0351 Tc [(udio-5)-530.2(\()-3.8(A)6(pplied)-531(B)3.4(iosystem)5.7(s,)]TJ -12.9796 -1.2114 TD 0.0085 Tc [(Ther)8.5(m)-9(o)-506(Fis)8.5(h)-9.6(er)-510.7(Scienti)]TJ /F12 1 Tf 9.5363 0 TD 0 Tc ()Tj /F11 1 Tf 0.5431 0 TD [(c)-7.7(,)-516(US)-14.4(A)-11.2(\))-9.1(.)-516(P)-10.9(ri)-14.5(m)-11.5(e)-7.7(r)-519.2(s)0(e)-13.7(q)-9.2(u)-11.1(e)-7.7(n)-8(c)-7.7(e)-13.7(s)-513.2(u)-11.1(s)0(e)-19.7(d)-512.4(f)-13.4(o)-7.3(r)]TJ -10.0794 -1.2114 TD 0.0112 Tc [(PCR)-508.7(\()2.1(Invitrogen,)-510.8(S)-4.2(h)11.2(a)-11.4(ngahi,)-510.8(China\))-511.1(wer)11.2(e)-521.7(as)-508(follows:)-510.8(m)11.2(o)-7.6(u)0.1(se)]TJ T* 0.0404 Tc [(GAPDH,)-541.3(ACCCAGAAGACTGTGGATGG)-540.6(\()-4.5(for)4.6(w)-4.7(ar)4.6(d\))-541.6(and)]TJ 0 -1.2055 TD 0.0375 Tc [(CACATTGGG)5.5(GGTAG)5.5(GAACAC)-529.9(\(reve)5.9(r)1.7(se)5.9(\);)-532.2(mouse)]TJ /F14 1 Tf 22.7308 0 TD 0.0368 Tc (Cd206)Tj /F11 1 Tf 2.7093 0 TD 0 Tc (,)Tj -25.4401 -1.2114 TD 0.0484 Tc [(TCTTTGCCTTTCCCAGTCTCC)-548.8(\(fo)5.3(r)-5.3(war)-5.3(d)1.5(\))-545.5(a)-3.9(nd)-547.6(TGACA)]TJ T* 0.0599 Tc [(CCC)5.7(AGCGGAATTTC)-555.2(\(reverse\);)-557.6(mouse)]TJ /F14 1 Tf 19.0189 0 TD 0.0607 Tc (Arg1)Tj /F11 1 Tf 2.1424 0 TD 0.6175 Tc [(,A)558.5(G)555.7(A)558.5(C)557.4(A)]TJ -21.1613 -1.2114 TD 0.0434 Tc [(GCAGAGGAGGTGAAG)5.4(AGTAC)-541.9(\()-1.5(forward\))-538.6(and)-540.6(GGTAG)]TJ T* 0 Tc [(TCAGTCCCTGGCTTATGGT)-463.9(\(reverse\);)-457.5(mouse)]TJ /F14 1 Tf 20.1886 0 TD (inos)Tj /F11 1 Tf 1.5993 0 TD [(,)-456.3(CCCTT)]TJ -21.7879 -1.2114 TD 0.0228 Tc [(CA)5.6(ATGGTTGGTACA)5.6(T)-1.7(GG)-522.4(\(forward\))-517.4(a)0.3(nd)-519.4(ACA)5.6(TTGATCT)]TJ 0 -1.2055 TD 0.0302 Tc [(CCGTGAC)-6(AGCC)-531.2(\(revers)-5.6(e)-1.4(\);)-533.6(m)-5.2(o)-0.9(use)]TJ /F14 1 Tf 16.1127 0 TD 0.0318 Tc (Tnf)Tj /F16 1 Tf 1.4919 0 TD 0 Tc (a)Tj /F11 1 Tf 0.6564 0 TD 0.0311 Tc [(,)-526.7(T)0.6(C)-5.2(TTCTCATT)]TJ -18.261 -1.2114 TD 0.0548 Tc [(CCTGCTTGTGG)-556.1(\()3.9(forward\))-557(and)-553.1(GGTCTGGG)4.9(CCATAG)]TJ T* 0 Tc [(AACTGA)-448.7(\(reverse\).)-451.5(Fold)-453.8(induction)-448.7(of)-450.3(target)-448.2(gene)-448.7(expression)]TJ T* [(was)-318.3(calculated)-320.8(using)-321.7(the)-320.5(comparative)-323.6(method)-320.6(by)-313.1(normalization)]TJ T* [(to)-302(the)-296.6(internal)-308.5(control)-301.8(GAPDH.)]TJ /F1 1 Tf 11.9999 0 0 11.9999 306.1417 135.0992 Tm [(Flow)-302.2(Cytometry)]TJ /F11 1 Tf 9.5 0 0 9.5 306.1417 123.5905 Tm [(T)-6.6(h)0(e)-527(f)-7.4(o)-7.3(l)-6.6(lo)-7.9(w)-9.3(i)0(n)-10.6(g)-520.7(re)-13.7(ag)-12.1(e)-7.7(n)-8(t)-521.5(a)0(n)-12.6(d)-524.3(an)-12.6(ti)-10.9(bo)-8.5(di)-13.7(e)-7.7(s)-519.2(w)-9.3(e)-7.7(re)-526.9(pu)-10.3(r)-12(c)0(h)-7.8(a)-10.6(se)-7.7(d)-524.3(f)-7.4(ro)-13.2(m)]TJ 0 -1.2055 TD [(The)-8.5(rmo)-520.1(Fishe)-9.6(r)-519.2(Scie)-9.5(nti)]TJ /F12 1 Tf 9.4289 0 TD ()Tj /F11 1 Tf 0.5311 0 TD [(c)-515(\(Ca)-8.2(rl)-6.6(sbad,)-521.1(US)-8.5(A\))-515.6(and)-519.1(use)-12.9(d)-512.4(i)0(n)]TJ /F12 1 Tf 13.9882 0 TD ()Tj /F11 1 Tf 0.5311 0 TD (ow)Tj -24.4793 -1.2114 TD 0.0655 Tc [(cytometry)-580.5(a)1.2(nalysis:)]TJ /F12 1 Tf 9.6915 0 TD 0 Tc ()Tj /F11 1 Tf 0.5968 0 TD 0.0684 Tc [(xa)4.1(ble)-571.9(v)1.2(i)6.1(a)-1.8(b)7.4(i)0.2(lit)6.4(y)-571.6(dy)7.2(e)-577.8(\()5.6(FV)7.5(D-)4.7(eF)3.6(lu)3.6(or)]TJ -10.2882 -1.2114 TD 0.0472 Tc [(506\),)-558.3(a)0.8(ntimouse)-557.3(F4/80)-559.9(\()2.3(F)-5.7(I)4.2(TC\),)-558.3(a)-5.1(n)3.4(timouse)-557.3(C)-1(D11)-4.9(b)-556.8(\(PE-)]TJ T* [(Cy7)-4.9(\))2.3(,)-558.3(a)0.8(ntimouse)-557.3(CD206)-559.9(\(APC\),)-552.4(a)-5.1(n)3.4(timouse)-557.3(i)-3.1(NOS)-559(\()-3.7(PE\),)]TJ ET 0 0 0 0.7 k 45.354 737.518 504.567 0.28345 re f BT /F6 1 Tf 6.9999 0 0 6.9999 45.3543 744.2644 Tm 0 Tc [(Wang)-303.4(et)-300.5(al.)]TJ /F4 1 Tf 56.9126 0 TD [(Trichinella)-298.7(spiralis)]TJ /F6 1 Tf 7.6537 0 TD [(Attenuated)-302.9(Colitis)]TJ ET 45.354 42.803 504.567 0.22675 re f 45.354 42.803 504.567 0.22675 re f BT 6.9999 0 0 6.9999 45.3543 31.2945 Tm [(Frontiers)-306.1(in)-296.3(Immunology)-503.1(|)-502.8(www.frontiersin.org)]TJ 52.8468 0 TD [(October)-304.5(2020)-505.2(|)-494.7(Volume)-307.7(11)-499.6(|)-494.7(Article)-305.6(563784)]TJ -17.0811 0 TD (3)Tj ET endstream endobj 55 0 obj<> endobj 56 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 57 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 58 0 obj<>/Border[0 0 0]/Type/Annot>> endobj 59 0 obj<>/ColorSpace<>/Font<>/ProcSet[/PDF/Text/ImageC/ImageI]/Properties<>/ExtGState<>>> endobj 60 0 obj<>stream /GS1 gs BT /F11 1 Tf 9.5 0 0 9.5 45.3543 139.2945 Tm 0 0 0 1 k 0.0235 Tc 0 Tw [(anti-CD)-5.4(2)1.2(7)-4.7(9)-535.9(\(P)-5.3(D-)-4.4(1\))-534.6(\(P)-5.3(erCP-)-4.4(e)-2.1(Fluor)-537.5(7)-4.8(10)-4.7(\),)-540.3(and)-536.6(C)-0.8(D)-5.4(16/)-6.6(CD3)-4.8(2)]TJ 0 -1.2114 TD -0.0139 Tc [(mo)-13.9(n)6.6(o)-13.9(c)6.9(l)-13.9(on)-13.9(a)9.3(l)-307(an)-13.9(t)5.6(i)-13.9(b)6.1(o)-13.9(d)9.5(y)-13.9(.)]TJ 1.2651 -1.2114 TD -0.0231 Tc [(Fo)-6.5(r)-375.2(M)-3.4(1/)-5.5(M2)-373.6(m)-4.8(a)2.1(c)-6.9(r)0.7(o)-6.5(p)1.6(h)-5.3(a)-3.8(ge)-376.9(ph)-5.3(eno)-6.5(t)-1.6(yp)-4.4(e)-376.9(a)2.1(n)-7.3(a)2.1(l)-5.8(y)-0.7(s)-5.2(i)-1.8(s,)-378(2)-3.6(?-0.1(1)-3.6(0)]TJ 7.1249 0 0 6.3326 246.5007 120.5291 Tm 0 Tc (6)Tj 9.5 0 0 9.5 253.2472 116.2771 Tm -0.0225 Tc [(ce)-6.3(lls)-374.6(we)-6.3(re)]TJ -21.8834 -1.2114 TD 0 Tc [(s)11.9(t)0(a)22.9(i)0(n)19.2(e)0(d)-490.3(w)0(i)23.9(t)0(h)-491.8(a)13.3(nt)19.5(i-)23.2(F4)20.3(/)11.7(8)0(0)21.1(-)0(F)20.6(I)0(T)22(C)0(,)-486.6(a)0(n)17.2(t)0(i)24.9(-)0(C)19.4(D)12.9(11)21.1(b-)18.5(P)13(E)13(-)0(C)19.4(y)0(7)23.9(,)-504.1(a)13.3(n)0(d)-490.6(F)12.7(VD)17.6(-)]TJ T* [(eF)11(luo)16.8(r)-513.2(506)16.7(\))-510.4(for)-504(30)-504.1(min)-499.6(at)-508.2(4?12.3(C)-507.7(aft)15.5(er)-509(mou)17.8(se)-509(Fc)-502.2(was)-503.3(blo)14.7(cke)14.1(d)]TJ 0 -1.2055 TD -0.0196 Tc [(\(CD16/CD32\))-500.1(for)-503(2)-0.1(0)-501.4(m)-1.3(in.)-505.8(A)-1(fter)]TJ /F12 1 Tf 13.7196 0 TD 0 Tc ()Tj /F11 1 Tf 0.5072 0 TD -0.0194 Tc [(xation)-498.9(and)-502(p)-0.7(ermeabilization,)]TJ -14.2269 -1.2114 TD -0.0204 Tc [(intracellular)-426.2(s)-2.5(ta)4.8(ining)-427.7(w)0.2(as)-426.2(carried)-431.4(o)2.2(ut)-422.6(with)-426.3(anti-CD)4.4(206-)5.4(APC)-426.6(a)-1.1(nd)]TJ 27.4512 7.2626 TD -0.0211 Tc [(anti-iNOS-PE.)-208.9(C)2.3(e)-4.9(lls)-206.1(that)-202.5(we)-4.9(re)-207.8(FVD)]TJ 7.1249 0 0 6.3326 432.9637 143.4897 Tm 0 Tc (-)Tj 9.5 0 0 9.5 437.2156 139.2945 Tm -0.0205 Tc [(were)-207.2(identi)]TJ /F12 1 Tf 4.1714 0 TD 0 Tc ()Tj /F11 1 Tf 0.5132 0 TD -0.0206 Tc [(ed)-210.8(a)4.6(s)-205.6(living;)-202.4(F)-1.9(4/80)]TJ 7.1249 0 0 6.3326 545.8392 143.4897 Tm 0 Tc (+)Tj 9.5 0 0 9.5 306.1417 127.7858 Tm -0.0196 Tc [(and)-293.3(C)-2.1(D1)5.9(1b)]TJ 7.1249 0 0 6.3326 348.6046 131.9811 Tm 0 Tc (+)Tj 9.5 0 0 9.5 355.2944 127.7858 Tm -0.0175 Tc [(ce)4.6(l)5.7(l)-0.2(s)-292(w)3.1(e)4.6(r)0.4(e)-293.7(i)3.8(de)4.6(n)4.3(t)4(i)]TJ /F12 1 Tf 6.1527 0 TD 0 Tc ()Tj /F11 1 Tf 0.5132 0 TD -0.0212 Tc [(ed)-300.9(as)-295.7(mac)-5(r)2.6(ophag)-4.8(e)0.9(s;)-298.5(F4/80)]TJ 7.1249 0 0 6.3326 513.1274 131.9811 Tm 0 Tc (+)Tj 9.5 0 0 9.5 519.8171 127.7858 Tm -0.0187 Tc [(CD)6.1(11b)]TJ 7.1249 0 0 6.3326 545.8392 131.9811 Tm 0 Tc (+)Tj 9.5 0 0 9.5 306.1417 116.2771 Tm -0.0201 Tc (CD206)Tj 7.1249 0 0 6.3326 331.9369 120.5291 Tm 0 Tc (+)Tj 9.5 0 0 9.5 338.5133 116.2771 Tm -0.0162 Tc [(ce)5.9(l)7(l)1.1(s)-278.8(w)4.4(e)5.9(r)1.7(e)-280.5(i)5.1(d)8.5(e)0(n)5.6(t)5.3(i)]TJ /F12 1 Tf 6.1288 0 TD 0 Tc ()Tj /F11 1 Tf 0.5132 0 TD -0.0206 Tc [(ed)-282.4(as)-283.2(M2-type)-284.9(m)3.7(acrophages;)-286(a)-1.3(nd)-282.4(F4/80)]TJ 7.1249 0 0 6.3326 545.8392 120.5291 Tm 0 Tc (+)Tj 9.5 0 0 9.5 306.1417 104.7685 Tm -0.0201 Tc (CD11b)Tj 7.1249 0 0 6.3326 332.1637 109.0204 Tm 0 Tc (+)Tj 9.5 0 0 9.5 336.0188 104.7685 Tm -0.021 Tc (iNOS)Tj 7.1249 0 0 6.3326 356.2015 109.0204 Tm 0 Tc (+)Tj 9.5 0 0 9.5 362.948 104.7685 Tm -0.0222 Tc [(ce)-6(lls)-302.7(wer)-4.3(e)-298.4(i)-6.9(d)2.5(e)-6(n)-0.4(ti)]TJ /F12 1 Tf 6.1586 0 TD 0 Tc ()Tj /F11 1 Tf 0.5132 0 TD -0.0205 Tc [(ed)-300.2(as)-295(M1-type)-302.7(m)3.8(acrophages.)]TJ -11.3863 -1.2114 TD 0 Tc [(All)-293(cells)-303.2(were)-299.2(subsequently)-299.4(detected)-302.4(using)-303.7(a)-297(B)0(D)-293.3(LSRFortessa)]TJ /F12 1 Tf -1.2651 -1.2055 TD ()Tj /F11 1 Tf 0.5311 0 TD [(ow)-207.5(cytometer)-215.3(\(BD)-206.9(Biosciences,)-217.1(Heidelberg,)-214.1(Germany\),)-214.6(and)-208.8(data)]TJ -0.5311 -1.2114 TD [(were)-299.2(analyzed)-308.5(with)-300.8(FlowJo)-298.4(software)-307.2(\(BD)-296.4(Biosciences\).)]TJ ET 0 0 0 0.7 k 45.354 717.505 m 549.921 717.505 l 549.694 717.222 l 45.581 717.222 l f* 549.921 717.505 m 549.921 170.306 l 549.694 170.532 l 549.694 717.222 l f* 549.921 170.305 m 45.354 170.305 l 45.581 170.532 l 549.694 170.532 l f* 45.354 170.305 m 45.354 717.505 l 45.581 717.222 l 45.581 170.532 l f* /EmbeddedDocument /MC7 BDC /Document /MC8 BDC q 136.027 699.76 232.078 -205.919 re W n q 232.596024 0 0 206.43602 135.522003 493.812042 cm /Im1 Do Q Q q 367.625 699.76 99.581 -445.663 re W n q 100.116035 0 0 446.676025 367.60202 253.572006 cm /Im2 Do Q Q q 136.027 494.322 232.078 -206.399 re W n q 232.596024 0 0 206.43605 135.522003 287.892029 cm /Im3 Do Q Q q 136.027 288.403 232.078 -34.305 re W n q 232.596054 0 0 34.836014 135.522003 253.572006 cm /Im4 Do Q Q BT /F17 1 Tf 7 0 0 7 145.4286 690.7834 Tm 0 0.00392 0 rg (A)Tj -2.0066 -11.2381 TD (B)Tj 0 -10.7857 TD (D)Tj -0.4733 -16.5 TD (E)Tj 0.4733 -12.0089 TD (F)Tj 20.2039 39.2946 TD (C)Tj ET EMC EMC BT /F1 1 Tf 6.9999 0 0 6.9999 50.6268 233.0645 Tm 0 0 0 1 k [(FIGURE)-299.4(1)]TJ /F6 1 Tf 5.0053 0 TD (|)Tj /F4 1 Tf 0.6479 0 TD [(T.)-303.8(spiralis)]TJ /F6 1 Tf 4.3087 0 TD [(AES)-297.1(alleviated)-311.5(DSS-induced)-299.5(colitis)-301.7(in)-304.4(mice.)-302.8(Mice)-297.4(were)-302.1(divided)-307(into)-295.6(5)-306.5(groups)-298.4(with)-303(6)-298.4(mice)-305.5(each,)-301.3(treated)-300.4(with)-303(DSS,)-297.6(DSS+AES,)-309.5(CloA,)-295.1(and)-306.5(CloA+)]TJ -9.9619 -1.3607 TD [(DSS,)-297.6(respectively.)-306(Another)-300.8(group)-299.6(of)-307.6(6)-298.4(mice)-297.4(were)-302.1(given)-307.1(PBS)-295.1(as)-298.8(normal)-303.3(control.)]TJ /F1 1 Tf 33.8949 0 TD (\(A\))Tj /F6 1 Tf 1.5631 0 TD [(The)-302.2(detailed)-301.4(study)-301.3(regimen)-303.6(including)-299.8(time)-305.8(points)-305.7(for)-295.3(administration)-304.5(of)-299.5(DSS,)]TJ /F4 1 Tf 32.186 0 TD (T.)Tj -67.644 -1.3526 TD (spiralis)Tj /F6 1 Tf 3.183 0 TD [(AES,)-302.5(and)-298.4(CloA.)]TJ /F1 1 Tf 6.941 0 TD (\(B\))Tj /F6 1 Tf 1.5793 0 TD [(Percentage)-306.4(of)-299.5(mouse)-305.2(weight)-302(loss)-297.3(after)-305.7(treatment)-297.5(\(n=6\).)]TJ /F1 1 Tf 23.8277 0 TD (\(C\))Tj /F6 1 Tf 1.6279 0 TD [(Clinical)-299.9(disease)-302.4(activity)-302.9(index)-298.5(\(DAI\))-302.2(was)-304.9(assessed)-298.9(\(n=6\).)]TJ /F1 1 Tf 23.9167 0 TD (\(D\))Tj /F6 1 Tf 1.6198 0 TD (Representative)Tj -62.6954 -1.3607 TD [(colonic)-295.5(length)-307.6(from)-299.4(each)-304(group)-299.6(\(left\))-302.6(and)-298.4(average)-307(reduction)-298.5(in)-304.4(colonic)-303.6(length)-299.5(\(right\))-299.4(\(n=6\).)]TJ /F1 1 Tf 38.0821 0 TD (\(E\))Tj /F6 1 Tf 1.5307 0 TD [(H&E)-302.8(staining)-299.5(of)-299.5(representative)-304(colon)-302.2(samples)-306.3(from)-299.4(each)-304(group)-299.6(\(left\))-302.6(and)]TJ -39.6129 -1.3526 TD [(the)-295.9(changes)-305.2(in)-296.3(histological)-304.2(score)-301.7(in)-304.4(each)-295.9(group)-307.7(is)-299.7(shown)-302.4(on)-293.9(the)-304.1(right)-299.5(\(n=6\).)]TJ /F1 1 Tf 32.4046 0 TD (\(F\))Tj /F6 1 Tf 1.4659 0 TD [(Myeloperoxidase)-308(activity)-302.9(in)-296.3(mouse)-305.2(colons)-301(of)-299.5(each)-304(group)-299.6(\(n=6\).)-305.5(Experiments)-306.4(were)]TJ -33.8706 -1.3607 TD [(repeated)-303.2(in)-296.3(triplicate.)-309.4(Data)-296(are)-304(expressed)-307(as)-298.8(means)-298.6(?-306(SEM.)]TJ /F18 1 Tf 25.7876 0 TD (?Tj /F1 1 Tf 0.3645 0 TD (?Tj /F18 1 Tf 0.5912 0 TD (?Tj /F6 1 Tf 0.6641 0 TD [(indicates)-308.9(sacri)]TJ /F7 1 Tf 6.0501 0 TD ()Tj /F6 1 Tf 0.4374 0 TD [(cing)-303.4(of)-299.5(mice.)-302.8(*indicates)-306(signi)]TJ /F7 1 Tf 12.092 0 TD ()Tj /F6 1 Tf 0.4373 0 TD [(cant)-296.2(dif)59.5(ferences)-300(between)-305.7(experimental)-309(groups)-298.4(and)]TJ -46.4242 -1.3607 TD [(controls.)-302.8(*)]TJ /F4 1 Tf 4.3168 0 TD (P)Tj /F6 1 Tf 0.9233 0 TD [(<)-306(0.05,)-298.6(**)]TJ /F4 1 Tf 4.082 0 TD (P)Tj /F6 1 Tf 0.9233 0 TD [(<)-306(0.01,)-298.6(***)]TJ /F4 1 Tf 4.4221 0 TD (P)Tj /F6 1 Tf 0.9233 0 TD [(<)-306(0.001;)-297.3(ns)-302.1(=)-306(not)-294.5(signi)]TJ /F7 1 Tf 9.7433 0 TD ()Tj /F6 1 Tf 0.4374 0 TD (cant.)Tj ET 0 0 0 0.7 k 45.354 737.518 504.567 0.28345 re f BT 6.9999 0 0 6.9999 45.3543 744.2644 Tm [(Wang)-303.4(et)-300.5(al.)]TJ /F4 1 Tf 56.9126 0 TD [(Trichinella)-298.7(spiralis)]TJ /F6 1 Tf 7.6537 0 TD [(Attenuated)-302.9(Colitis)]TJ ET 45.354 42.803 504.567 0.22675 re f 45.354 42.803 504.567 0.22675 re f BT 6.9999 0 0 6.9999 45.3543 31.2945 Tm [(Frontiers)-306.1(in)-296.3(Immunology)-503.1(|)-502.8(www.frontiersin.org)]TJ 52.8468 0 TD [(October)-304.5(2020)-505.2(|)-494.7(Volume)-307.7(11)-499.6(|)-494.7(Article)-305.6(563784)]TJ -17.0811 0 TD (4)Tj ET endstream endobj 61 0 obj<>stream ?Adobed       \  s!1AQa"q2B#R3b?r%C4Scs?D'?Tdt& EFVU(eufv7GWgw8HXhx)9IYiy*:JZjzm!1AQa"q2?BRbr?$4CS%cs?DT &6E'dtU7()󄔤euFVfvGWgw8HXhx9IYiy*:JZjz ?N*UثWb]v*UثWb]v*UثWb]v*? b|'w&?7]ɼN*MqWroxUܛ?w&?7]ɼN*MqWroxUܛ?w&?7]ɼN*MqWroxUܛ?w&?7]ɼN*MqWroxUܛ?w&?7]ɼN*MqWroxUܛ?w&?Qu?,Z޵_'۵ʻWtUl܉k<i:3xlUB_?k?W#bNw_.by̺Wto͘g}*;a^?SCMi-b"xX4,qWK_⬓AVg\MPWybIi숄ҜwPK ?ߛ})on4}V$ _QƼYU{Ufj?_V?khAAy?ъs\m(7|Xq jQTJkVfɧ?AY]C)> ]v*UثWb]v*UثWb]v*UثWb]|?9s޾2č%z V>ՊN*/Vzc8?SQTU+\H#?'xϝXeu訴KUث?$? ?3V;c=չ> |hqUȻu?E܋?i>NWZ ㊧1iy?3XHI[^.ѽ@Xӗ$???nnzd0?$pMDPA\U/TŬoi}ek2nV-F*"2t9ę-O ?P7^v*UثWb]v*UثWb]v*UثWb]v*U Z~i scv?UY[??WnG6ZCt?"K?-R}2J85늲+zIy#[7?ܱ'H~`iu:1Vv?hH_O"O/U[_ob;ɴ?^T RE`CVRjyjrie? + zro???מx[kR 4IEeB#f@>4^m?Ƀ8jg ?rn[(hzK]v*UثWb]v*UثWb]v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWbRgodVz/ם|kR(GjbHt}* VXmbE]T1U,:W?2eiC jaQE LUNI?mRlUVw1, B?miz%)LUv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uت_c]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UتF*v*UثWb]hfI Іq]#gUy+ LU~*UتŞYJs@AeJ_v*UثWb]v*UثWb]v*UثV?N^_S[D-$HT_*qTbX?_@?Jj`N*~ayY u~ Cю`@yΩ4>iy~?֖vy*@=\Uy-,A ޯi'fH-"p?x?eN*?=OyRmQ9?i+x4u"fWb?0<ϧ~oh^Ois̗(є R'ڇ?TH`yF?WNqWb<V]Aц?Z[oX[5?^Ts |bUثWb]v*UثWb]v*UثWb]v*UثWb]1UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]]+2G1? TQ?'ͭA9M&Vm-ymeDgP*^?Xyk˚~?,"2~> b UĿm^"Ny>"?_9K;HiSRFk|U)󏒯<sM*a&ZGst2IG`SlUNPYAۣo{ean?YX*(>$tVfy?EPv`+RچS̐5C,R2T? gqGOn]ȻRӧSK̻XNmb~jJ{}QF͊X.jV\PFZWq_5i?['׽Uv.UsG?{ $ utR/L󞳪iw+.}a /}2̫R<1TWFj?g ZxWWu]7T[?g?B?@j~rt-5Z)eUjS?GwUv*UثWb]v*UثWb]v*U&|?0?'N*\{`8_,y]PB2T\}JUgGSP? yFA4?P5 *?=qTqi/25u; xA=B+\>_]i?۞&OGzW@?F*UK???;vI63%_U?(UB; @IvuݽN>J? UeM4_~ͼ4v~U~tξU~?o,c QzCtE1TSCKA_iWxZHI7??ToaHOxEV \7)XS?yDyr?%?YZJ/?eGϐ}IuFEڂRyTڶM 1PLs@M1To0ƛ^Y ?ׯoVfF wV=)b_Z֗hܾiֵ)]rRd?U?Wb]v*UثD@'sohW??UثWb]v*UثWb]1UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]Mb?ǚg&zݝ]— I ]??ɽC󧓇0hUe P@)'K??n_"kq?eLЇ??HGѷ#N*?m&<•vy[ .etՁT??TCYoG~i󏗤v[L4OE@aTqQ?B[{,v[*?/?+%A?ݍ?+*?u?LvK[OGV&%jv?rX'{EH֔P:u N?VX?΁yǖY}ZC)JVC-kMz}hNI??P֬OLUkɿ?kzPWI֣k~I}O?~Y5<[o*8wuQˠxv*UثWb]x7o?3M淪F ?iHZ/?J?^C[PZl:7*οKci&ѼN/T W˺w ⯫"WX] HbWb]v*UثWb]v*Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*pHAҸt?TV?;xm=82ư>e~O\jȍkQ??Tۦ 3iZ\ BF[?xz5?VCO$ikזPGiEJ\U(>K?ǔ%hIlWhxm! M4 ?,ekv  Ob?.<ݧSi@Ԣ}^C(*vNzK{"^4 <A@*zb?g|:ܷ VM?qW~Xy7~Z??NBhȭ??>J1[?01^yToQካy/r?3}BӵĎ4H $B*XSz튱S?xi=rԴCבe'ʼnBoMF?;Ey{= YZ4Ib?/>|u6 ?M|G8ڴ_vbgΑwiɼԧo_PePS U6]v*UثWb]v*UثWb]o IC~U??@~^?kHd~̯3\Ua\Z\qL"q??FtU Uv*o/?S,RrUCSbMyckhtVdTQbFOF*?x! !c K0E V=I|Um-&nR?iFvPȦsYYh#e_sYٲkP>B(ӄhʠ UBJ{{8!O?qWŀјE?ّ`G?ءK+XPV?O@QWb]v*UتWo0^?u]jtBeg?o UWSz|?? 9^>y+R}4N?׭iF5?>/z^݊v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWbX?헞4M>[E$Ж׉⬭"*HPNoUUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uf?:>? CR? 銽CTi6 AVR=Wqϖ^kf?Iq.U AA8늽%eۛHUv*UثWb]v*UثWbUUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbT1UWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]?%YLx??_v*UثWb]v*UثWb]&/^?bD]v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWb]v*U柑׿}'z^*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWz??gqbWb]v*UثWb]v*UثW`lU蘫Wb]v*UثWb]v*U^/]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UJnS]v*UثWb]3?oK]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*_gQ1?T~U~*UثWb]v*UثWb]v*yPv*UثWb]v*UثWb]1UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]MbxWb]v*UثW~F?^|UxWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb^{b??UثWb]Ͽ~W??[y?Z?ZS\UꘫWb]gd/ʑz?FS(_֛~u x ?jV?]@kn? y,Djf?v`? WR[;H?G'#̱d^v*Uث|??A2zRFR?UثWb^a/?)?"y-??|k3??%!U ltR[R?m3z;o?T֎sK.~V|jw_鳵LF@uc4]ak+M6{l$P QIa?woJM m)ԚH??2تF5uI??嫋-qi xDfTzv/4[I0SPqTV*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWb^}u =:FX7?2C_aMMy RMN*]cϽU6I7{??qWk?}?40?憹m~ZtN\Xju^?CkԓyӊX?ow RMN*]cϽU6I7{??1<V1γz?Ԧ*?OMgMѬ4 6Or ZqLUCkԓyӊX?ow RMN*]cϽU,?泭wRo!7[O#R=V-?ѭ]ZM w|^d`mJ{bX?ow RMN*]cϽU6I7{?muo>?qWK\?嫫ye)Vڦӿm5o>?qW?}?4?Ii]CkԓyӊX?oy?34~ek嫻uf2zR?iCX?ow RMN*]cϽU6I7{?muo>?qVm?J?}?Gr_Ys x̣ZҞتoCkԓyӊX?ow RMN*]cϽURk:&^FomG?{Wa_志ﴧkT+'QS?^?CiԓyӊX?ow RMN*]cϽU6I7{?|h_ߟ?S ^9caXd?;X?ow RMN*]cϽU6I7{?muo>?qWe~hr|ƾZ#r Di?9i?ow RMN*]cϽU6I7{?muo>?qW~lyBti]vIFQڀVU*kS_?i7ֺ. ce?K "nJɆ*?r`̡e??.ȱW"F?U? 393u?=L]G DybZp՗?8^do+ o!E[˵RZ@Fr?TqV;:?2dsɚOrqTY~Z?O|.?B+@M8|Iy*v_ZOu މ{ UWgn?F0]D{,Vy"5]߼ZkTҵH (QYG÷LU9]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UJnS]v*Uث*? U<1WPxb]Aኺu? U<1WPxb]Aኺu? U<1WPxb]Aኺu? U<1WPxb]Aኺu? U<1WPxb]Aኺu? U<1WPxb]Aኺu? U<1WPxb]Aኺu? U<1WPxb]Aኺu???<^kyݜQW??U@glEbr}(;]ҽb`uߜu+MCYid"ăW\RiЋ}WW+?ڴv?YVhYeeA Qb?ȟ'{v{U?'1!n#E̚Ǚy-mv?[ӌ ʘOyߚ>:eZC G&; ^ykݜҸ.M>;} 'jyxSry?&zgkccK ,PB{ Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UتF*v*UثWb]`lt-&}R>B? ٙ^]~{ˬyrF ?0v 2|?WiZ[?,wH$e5 ⨬UثWb?FȺ|W7m?[?iHI~yv*bR$桩W]v*OΫ:?STFKTOJ ¼Z|^m9jӦGogfxY~L=VAv*Uy^ͦ]I%?<8[o۩?Vwv*UNK("RJ?ZM+?B93F>ԋ|U#d6?؂1Tv*UNky.'q0y yw8ˢB~L?Ue15Jt^{NezW??~.+B;8WbXMd~H7 !Kt)?5?k?v*UثTas]#ʰ#rY\(׻;X77<ի?| Å{브pƧ?2UثWbPZƳtږufgH4/7kai?< ?vH>?Ub]c^|~Sl.5kX-4?/ݵ/?,?V*O\^?w:us?LqWb]x7jLU?WbTn??Ko26zCMt[ ak <@P*y"LWzQZ?N*UثVԫŒT|F*o?E)i//PpAFv=> U~Xybo"hD?Vnr㊲UثV+cRym?ƦIu@y?F#Hܝ{w'{?UثWbgsUi,'\E%zk늱"gyG>CɶjBN "Abg]v*Z˻kgu=RF'uUdnȪ_U}9iWvTiZ?z|wlUWbTh%yb+^???6>K.z\zZZ4xA?"H?UثWb]v*UثWb]WbWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]RTWb]v*Uث VN=BWլ(B-> jUG??QWLC!-?žgUaR? %ӥv[yJ BPw_U9]>r򅧚Ӯo,cWzs^??*)R_Fb1jqPb_Vwkʋ+jlȀZִ?,-E? GЌUv*UJ+imdh*?? #VbNkwjSڙHU`?|U_?MO?lY~3 -Z@Y@b_]v*kHDrL#)`AmH@t=H ?]v*wykgm%?Y\UQܓbʯ1jo1CYHOneOdT⨧lUM?]ZXzk%XKIʈP⬟v*U jv:^q C-Z*.bq0/5_.{i{ ` zG?U#vo e;fS5cB;=F*UثW^-cmծ'N?CFWN*{ =t^yIBk-y=?nPS*dZwyzSU-?6ӊ֖vvmi [)1(DQ좀bثWbPjE[Q?LrDYZ@f(?*UثWbCBѵK?ndATV`<*Ei(cXE?TP@bWb]FU?N~HGȰ8? x-X`b~? 1ULUثU+[kw?AHPR/?aH?ci:^ N4P1T^*Uتx^Ya???X,m}HV@SUثWbPͦzmE% {iqWb]J+oYdm[KxkRB?>mm㵷_(P*]v*{ce}nװGsnnT:x1U?FtFb;DҤoqWb]CXFn?jsVcNQWb]v*UثWb]v*U^/]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UJnS]v*UثWb]v*UثWb]v*UتK?WT|jZUma/mjC0wqW??GH?^*O??{w '?H?׊?hk]C ?R4s5??G?W~ԍ??xa??FU0?GH?^*O??{w '?H?׊?hk]C ?R4s5??G?W~ԍ??xa??FU0?GH?^*O??{w '?H?׊?hk]C ?R4s5??G?W~ԍ??xa??FU0?GH?^*O??{w '?H?׊?hk]C ?R4s5??G?W~ԍ??xa??FU0?GH?^*O??{w '?H?׊?hk]C ?R4s5??G?W~ԍ??xa??FU0?GH?^*O??{w '?H?׊[?ڞo/okIm*?~Я UXWb]v*UثWb]v*U^/]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UJnS]v*UثWbG\t{u?_qT?1pLU=l/Z\G:?]v*UثWb]KXy?ĜleD䚝v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbUUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbT1UAϱ?In.$2O+K#nY?TqTVt?OZ{t8׼>?[]@Рn?x?'_⩖BEfk)[`&??hVёL?,?1WJf9]"} qV#w9A?Ta #rP?9= jG?*2խCb?@ָj g3m]~f\[D*M e#؍ULUثWb>P??Gp2M?``ynCTe ?v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]1UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]MbxWb]BwN= _7^M{y5YݤcƸ+мn5ڌ6.LhE\ѴN>FS??UA˶?HG?N,[UҌc#@Y@?p<<|٩zW+c B. rG^r`DAǼۦݹ? Uń]v*?IoX۟k/޿dUGFK~@ےw_qWbPZaˀe Ir4SMa@ 3ƦG?$UثWbR?E??4?@qV!Ϗ_1 j-?CsWz*U_Xɭs?UF@@|Uk^jtm2 FR4qڢi$_r[6h`i??} iT?RR][Dz柢 +H ;?EUIQ7idvP(Y?$bOnfܕ?bWf⩦]WR]5xN @VRTPK1;U?mZWRm#[lhHp7LU<皴2ZIy]o%V?T?q?Z}nlHa'z;.Q[?fEݴ~YZ [05?UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uت_c]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UتF*v*UثTjZ5}`t_S{ҭ9[L)Iu>+Z!Kv?SWZ jB?0DI?+RРb?^S?R iˇ>р?->zQh-٨?2r.;?ӎ] S> K"rg#u%?iFԝeNbK2Ix?un)pDOP^F2Gљ(YG@qWb]_ *M rC#?1Wџ?Xs^?rk8POڜI{6*U]2G?#J/$}bp~\`*!ss>NMثWb]ZZQnȳCo*aNeH ɿ?<^gJ}*?KjCKn\ ?A^ B?suPO??3|?ks'o\C?l?X\򯝼mMV@#??cM@ߙY?0~`^k^]GzR? B*qTAͺuӕ^//?’d`MIt߾*Tt^ 8Ґg?_|bcƟ"Z7⯱wȾeWoƭceF~`]IcdSO)iVU/u?ud@ ED?~*/^GՓK1mL?#2 ձW~Nj~^K?f?\?:̳\d((܈^yCpeEge(?_lU]v*UثWb]v*UثWb]v*UثWb]v*UثWbUUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbT1U]/B$֖{oФx. Bu}V}kba?IufUXo?MwSHZiP̲@? ?RI<{-?~^kK魐Y^"4HM#z~X<?H} U俖6s'o|}h ?CjP}v*UثWb]v*UثWb]v*UثWb]v*UثWb]WbWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]RTWb??byd4DNTUȬwv7HTЇGFU+n'/K no 1xq>"OW___}*b}?:e|_x?:ZdhHP6銢o#0U$EG#?u5VA|]g[}vz12a7kbEK? E ؤS`X?ʖG6=Nx5f>& jCCyMMST~[v*UثWb^?8f??DvOlU*Zku}8U9L}R;'\v*UثWb_?Z6k[78Vy1 ROƟ?n ??oו֧ ?#?\W |U/7~YySz]C)L!?VX?ZeQ-&xn[]LFqnZCA& TXZbOa-,]ɼjG>'P?nQ.֚[|WZXT}3CYLʓ?KtRM[%֓-^IӃ+M~#VߕMTVmCSҢ3}تuLqjq7@,T@0jT|T?ˍ6lGQVa|f_M*hzt?Ajwg$c^I4?/yۺYYW?}TIt+XmNwܹ@:svOWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UتIu֎KoɼNPL5?)hتY^I{?\ML[gPBу o*X6Kfwȗ6fWez(qWK$ҼRHŝI58UNkxf^2u¸UU 銷?P>ӝ}8ye)Y.7UMF Iw<:IH ]v*U<|KjS?-&{U*pOFJ2J*u nZ uaчb1TG?׬/"#?IQ?0U\c?o4ElZOfc? }@(Vb'`7'y6}PXhD| nn#v?ռu] vB>_E?ݸbxզ*?:k^o?_c jy.%aG^?5B eY#?$\ZVuv*Uثյ+ d}Jht7t o;d?I? 4U1Wb[͚Wo5/jm}fYxw0$}⬧v*UثWb]v*UثWb]v*UثWb]v*U^/]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UJnS]v*U%yGJH(zԮ*͡Yi+kt?Fe? t"U4:?MZ3y^kt vxwosmsT??U\UثWb]v*UثWb]v*UثWb]v*?cEQRO`1W?V^m5k[{=U?E ,(-ؗ?G?A8uy'-Os܋??|bm'F*Ǫ~mMt?K?aAʝbAYnb{XIYs \Uג?6%?_)LK?QWVv?WS~oyc嶷 ui2"r7z&*=3OA@o1VQ?^?k}ıhatPXGUe|{/sq^?KU$0?fm {@WqW?~c~a_siaw YA#HT =:bUqkdl䷳g&$fW*L֮?/jrI?Nщo?*t]mˬyHy] JPeX$g ylU\I~hAb[?-[}fvno#S^qV i|ؿFm /뉌MCFI?༩еi>joFifU"ґ1^_?^/?4|֚VT 6 wSoG_?2|Zv Μ SVBS?yZp?X[JVdWӈŤ u|>[_RĬORkLU(Լo?;5G%JIָpG(WڸV?SBSȲW?a\^ϊv*UثWb]v*UثWb]v*UثWb}Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbSu*UثWbPc- ?# VUj3ȲUu\Uei?M-?pk*Bˇr3v*UثWb]v*UثWb]v*UثWb]?3Zg_N?/.u=D?mC efE* h+_lU>|ҭRI?FkUIQJ}?f C?@)ފFP Oin5ch?A4Pk9?b c?ṱCWxmIb|HePWU1ka;;J?oD` I9C?YByW?Zv?:XpF?[iWUtfOAX-&e`WmV9Ps7Y&0:&r?;WM& ?_VP _fumD$P !u;ɟulYѴh$ݶa^H<?9q}C3~R,J/U$P?y:??]ԭ/bBqmRIdN] LU??675otB[T,?+KC huS-\?>KTn=eiiiUXFFSA㊵?.w{Q r@?B6q]rXZjڥ5$'Vfߖ\w r[GȤ GjD*|?ChZX޾ga5Z\i?mm?~{y+Um7G=F?K6\&ꇖ>qUs{!]X^iQKXjPUk= Khmgb?w?Vt͖fomPERK%mŷF`GQO,~evx!t+?[S?X?p?f+J늰}WyIY_Ϩ?"V :Lg?\EƏ`*\LHbzbv*UثWb]v*UثWb]v*UثWbUUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbT1UM)>8}b?ҏ~Xͨ1? V̭ ϱ??G?7?E)E(n*QٖrN5S?ږv]\L@ZlQvQOqWM3{c?)!V *[~[Ig[E$. ȪCG|Uv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثߘV?~I]:RKGQg~1SC9??&y[LNмE֚gQpoTJcɢf???ΒV}?W;?;TPK14U࿓Ad {=ܐoM[?g`6^?OR??dq*G?Mw?1vRH??0[8[FQqbrWwiZ~vglnX*6-R[k_?3?Z%o0?Z+Hic-?w kz*ɿ0l~X}[zV*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb?dxX%R?20?)؂6 C?O?R?8c~isc Q1ڜ^?/?&lvgN$BY YEv?UUPP(1VImY?\U(ޏO}I>䇐\Kn<???yǡhipI4w?U}m.mMXjk]?8~?f1rɯt*h`I)ܱ?ˊ~R*͆ rbwWbߝ??'R_Tf_NW;x{?1Gs[KA ^geB e^y@=LU~W٥Eڇچdf[?EىZRGy'ZV_ev*UثWb]v*OtE[BԬ}6I snNHثs?tWˑG&tog%»[\S~?h;??9?/?ߠTRB]ƛQ:k[u0goz?AqTS,UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Ud҈yJԱUcAZC保NJXzHS>?U< v~`X'\|ZUxOÃs UN*>d~M?=V̒y ͒~bf|鏩yOxP'" yucCEU)wǚdk?,v??Ɋ^ TA Sdz?^wP¼u?_w!F*s;PզF?g?ޛl%ʱ;!pXMJ]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbX]u+oΛ/c G%8 *|UE??0QNLK1=qTʺn|olj׶iw2P c!p:_ U)׿,ƕzMi Hd_⩮]#E72?{{ڍôS?z6Q{ U)?t2NM UÙ<gmbdϘ?^ږ?%?W?m?ך-:w??wss-lԥeŠ^8?~|P'C6ک@-ˁVSlU?hƵ>yUŵoR\K*'eT#*JnQօŵ.!?٢Yy#oAOeX~kF'Ѵ,-PT #4?Kt?\Z#m0%WbkC튳o=jrCKMGpSYe.'T,u}"͡Lw{5?f?@*1W*3?L`Z}E!F:DAX 8qWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*Uت٥Hbyd4?,(^?M?\\]hڙcs<=vYזu_пHX6xfVjMdUdZ l)x_Oͯi31W:ΝiTY?1V3?/]kȰ߈^ JSNbb^ Vl%?-RKU5OUD|[wG|dk𵺊֑E$LMGA'Q:y[ Υq4+iʡdfU{v*UثWb]v*UثWb]v*UثWb]v*UثԼգyއ???d`C=xfӲɓqw=\H_#|?um5}OKN+9 7YG/L`N[X]j;ǹ*?D߆kx?q}=bdy˞OhN|?rҽ\w0[=|Β?9#nhB&sVN̊ўq?n?W6B?kce4?w9?'e :ŨyLV??OJ ǎܨ;L4Z[\rM7Vh'hT?,]?kSbHD|?I-Bn?? Y?Gq`IǕu??bܥ?o"q?5A)krzd#db?~jyNdo?^94YP}fpY޿ݧMFde֬iM ?jfYonj8P$㊤>?.ow'쬟UWQG%SgxWb]yG+<??ţBD?y%@G%CTʾK?]/NLl4v`QVcV8Mǟ켭s1隥kƌPGUgثWb^u?y?s?\UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*F $T22+2ƽXZ?$y_̑`kξ`Xiᴴ²GK^ a*7?;ZyHƊOub>4 '}W^?k?U_T?OOmtL> qzgJqWb]v*UثWb]v*ԮӮkXcr?ev;e`'1xA _w ~ENԕ?ٱL |V:^sO .L3g,U~uEm*{bc_?ߑ@O?sـhOĎ|݁x?s{WCѴ3jV~`RI ̑U0Z1]{ L+ghsIㄥg` q?Pvj TѓfrFͯ~rh 5}PT?UO ??VE Ԓ={YO LIغDc!cf.[Auu=עr0NȠf?HwYI PJt?jd^i~^1[,i؊ ?a.wprsj'T!sM\Ty|P F*DNq_?\R9G%,i1iz#InFy[0kX%f2ic>|Ӭq]v*UثWbwWV֖]]L<8Aɝ٨T rP!̕%ߜ_Vyt-biciGhĕt;f\Œ6Uc+AUJӰm6SRі p܂TUy!;U95/4?u`vxYd%]M4R6XigC^jn?HYu;?Ol 5 9W1`T+# ޝW?Z]OOyE/UhaYoZNޘ?y͞Nodžl!@bc?\w@*?a8 oz?cJ9 qoIȆ(md^FDUi_?y[?yOSJm3ȓ$A/Np7?/?掑sT Znt^2& 0=d]v*Udм.X,TvGe>xƭ8^yVt?KeKdP?i IGf?VPMkצ*{8^hUh?Q,n(ɼhH<*,i:^?JO-2,2Т7?fUR@P*I1WK妲5M7JյKg[v9,VVycDn0fkE]%xK{UC AV?y?s?\UثWb]v*UثWb]v*UثWb]v*Uث 󏙼Giz}{^?XN*&M^yI??M}{Gsc#@z}QU?.?܅[XccFpHkUثWb]v*UثWbk?ITyf]5}+i0???zg?|ӭjg\TjWBb ]S[ UꘫNo*N*?}7[M7[?f"B̭ڼ튽iV(F UEHEgoTqW~Biz_̋SIfK?[ibIaiDP2.O7ϯyWϺ ^T֟[ I?I* qT旛n4?*zzƣm%`ѷ?d~qEWede𱘉U?Xo%ҠlQt&@qO꣖ofݞb2;fKK<XhWwz5?8MqdQI9ŏ&X? yʮ dH0_5yu{?HK[0VT"?/M5ͯC.E.1Y&@Y9cD|yw??|kiwi?k7D qRW͎n PM ˆGnQ?˚!)?ߤ __.%2yOj:V M#O.o :T1 ig7ٚ^,F8GSv7A\kh;(d8#|0Qw=<`^mƔKNu#[أ}ϰF?}q^Bý >X, @?qFIϏ7Δ^%]v*|?w]ff3OA35*nkb<:bWy? i55u?ې^En]{?N @늧8U]偑pI =D)OF*G^w?.~J?=u H]oBM!P#E4liAѿ*?t]֭m?5p?Dy UZi?o4?^YͥϚ!`GGRUzV*UثWb]v*UثWb]v*UثWb]v*U_Z "L?gWnJb2(\CA&??d~)t}S?Vޯ{$N{;HԢ(^> xf^r?Oފם{VWH}NK!m q?5?&lyb^"KƏf]W3?f&n4`)O UWb]v*Uث4x~WæyS^dLшZF(FVxS?|URi_)p~o?Y.$_aCS[$I#gv (?1jqj7zZ_}\̪=AX@8ojnϨwQY[/9g`lU$ѿ1|C,WeӒkOƣ{S: LU7BfȬl q3PIVcrzbf?k^{ML/泞H+C,QαŖo??V?^v*i&y(? ??%1? ֿ7a0MfU§K 5t̛7X]Kk[xEDGJ9RZ÷r?3?HݰvOO*XM?Y^RFR`,cfn?d>툿3 ?"c}BX]?oyST?L$M?m8&_bQ?ď?Gpiȥ_V_W qZx?~[C?_nӳ}&dp "ongOgKҝu4EցpZ!oVj?WW+?GQ?".wA~pyM{mnKc-?:|eg?tRVr}_`.O5h?_Y?O ?Ա^ǧYdžu˟e,?.IF?l#s\^\?4GsK qOQs9YNY̚^M?fF^~|19=~CwΡ /].A_?__,~sy;BgҢmD 2 6 [u?~@?)㕑gy2z|NJp5{qM۸VMoExG2?T>? V?Gټ\_|?#a~Mg?RLsxu_z)Wp4]Vfo=IWZFu?8f qF??Ɍ  ;t}%{}Dj׉% rw|; d??{#?fLgKUsf /?|>Af0dhԫ) #6H0ry@ ckWb]v*UثWbX/IMKT1PyV2E i?CG?? ?*--,?( M-֕nד1wEyh|,1WhIv}i..J';I/yST]RKCJ?Kӝ@˞G1mϫ|??Yc(`ĉhۜg^Wf>EoՇ~QM?kUثv`>ñxnw?#Ym?F?X^=DѰvD5*rF7q=??|C y淘??UC?ZEq?FIv(iȷ G]?L??c"=U?r]޹q͚~_[O*j^ӄ?,`y3A5r[T;|{Kajc\z/> 5@ogRW˓IVbK^IeSt;OV.%W6N"\PlQ,q/7$kvcآE5q? Y[wn?G?yѷ;CCo:?!`Jݯjn( '.8;XQs]7iZj Y$?yTP ?GhqLK#p_n?<}JWWsٲ*ܴQDY>סQ?@NCLD"??_^?PCiZ|%լoj?8NST_ظN8Uqo˽o$;^A1[Ex7/A5۟jҐg?q]?Y0_FG^*PvŌ:{}ˁCSl8Gm^GڏPqotHXy {~?l>}c'0qLʈf>YD?l3U{oat5}foԀzV"?O^m]?1>b!u{+?喟>j_}vrYĠ ʥ}`s|a{?7͞J]Vhm&_?7c upF@N٧̓:}8O.q=7MkRh 3{C ? r!f2vI?x?~6O"?[Msm ^ቧ=Woe?41 C?≰e!?ܱ/7nkmԚlQOVj@b 3?&< g<7ڝC?c1= Rmnf[jj}@5~fvNȏg^DؿG ?{w?2v*y g?]A!M=U+G@y.??'Qռ ]?rY?)#ұWb]v*Uث5?VpI?`<~ ^qTu5amWĚX ^s>'Q3B?軵 it-J?hʮҊSlU?j]NT6:ѷS+$hTm@HԀO]V љ? sϋÙ ے7+jv*Uث|ͫBM奅?ȚoI!?G?RU?v.|y`{^@HJyg~YhdmE#$?sk?¢2i?L2?.CHg<ړXm?Ntbu;^nϵH_:ٮ-YŌ?y/s7u]81mVIy1!JwŦ }areL?Vz{9ٹ'&IGUg3 H薑 |,8ݟ͉y:Ʊ}u'QF?]epԠ_չY8?ECN0b?Y'?i{y:jY?jsM(Xf>\ZiJ?ſUH~? $G8 }{>a:b]>k~xG{=F-K\+^Nlc?LYXB_Lm|?KI#7" ?xUǎpoa?]k#C?hnamsy"I>Veq wg!( ?tf]ZzpxLoYj}Ňt~.龉x?R6yOZʒ\ޤ6U?pG?=X %?{_O(NAd(O뢚b7MnOxS͛Ogt<<?Q?܍VY>_Q?JYKi{cKޢ6}rd2:G4}Nr>O-M+?AAd}`n,6 )[ Rzoj?!B7ID?ғxE=/BС?vfNUx?ހ<pݧu9! =nN `?~{2ie?uc>v%HdpH"?ɞ*U_efbE]v*xoFמXLXDexs* JV?U 92"?[uJӦP^nM̗oFf/$JG?ia_ b.ꟚZMGJC47 PQ g5X֯e??5~\ri~H ]D }&z_Jb]v*UثWb]v*yZIӎh.EܭY?WqV3q_]v*Uic xu[?^Ί_RݙD{b9#H:0AbU?x,hTuO}K̺}?Mam$㘆?!ZmRb^ä\X])YbaWS?iEk^^wrԥ?ĴQLW#?y??b^dBGCц*?^jZcж5)[E @GG&N*0l~X}[zV*?=3SJ]B ʄt*bc~\-gg\wyH{?hy>x--.zѴ:>Q~/?ǵݖj!Cu2b3cHFϒʰkzũƴC旴݉5c-O&4}?Di]a-O?K)}]%ͻS?W^p mϧ?pQL2b]Jv-;ӂ47:E}?*Z0@/?AF8* q46eay۬:f9*:g79s#GtSeu2.dv5?yQf{KXq,?f2e*I}k>R޺Nvn??_cڿI[?y̚o~Ǥk Ҁ~ I?TPSdc`x'[Ǫ}c?s<ǛazUDD=YG/.ܭ| LBDr(nf ~~8;F?u#?WwtʜTUi I,ڶي??yHWf۠?d|ϥce٦?1J% *~Syˑ?ޡ?'VsAqn΂BˏEy_aO|ɯ&KgQ؆?bބ&F(8FnbHG?Oo=r zu+gK+*_(ϾPwtyou Q*R2N?v8ڴǼw aUv*UثWb]v*UPTքPАw?|U^q֮շAKi?j7%IY*ȣuQײ{m}m?G?9ʭC\U~I򥇔yzG?SWݪINWb]WEU踫Wb]v*UثWb]v*UثWb]P짽Ekl??EU'#)?p? .R4E?ǘtZϘQe?s+?Slk"sc鳺d0?Kы?sF?{}OFfn0HQH@@?j4FsG?F?q?-Ǜ5+?K㰟Izw&PDU7=U?T?sMT:M݄"ކV n5'?K0GHm4[,zM d?`Z,ިr?cuS/[???F*?v*UثWjvaS^e֦?1p?P|h=TgGƖ档rX|Dd}lUy+jkּ̺Yg6Z ~4|HIqVsyW?H?˭2Jf?(?L a˶*~ljWwu6outk? :?V\U4u_(y7WTܟTO % j=GJ?Ay[>TO)wJmnbniKCsЁM0l~X}[zV*UhCQ_C_zv{n`|Qc?q>GxrDHyʑg~ڿ4mHӝ5?Fr? e{^??2[?R\ǻpmͿK7Vn܃^M9?%??$?|l ogn8t?w'9̹eFR6K??fVUثWb]@ki`9!؂ C)CɌLQ?LgAkZ??]y~Vi:nN +xgziqv]87C[噵DO?hd@A=st1͐e1 wyNVC$^v YIUyBJ\K=|5ZaƧlUZW|yRMîj?uIAȢNY*U㟝ߖ~kռy=R^ԨdqI U5e#lUIyzǒ4??_M5Gm4r"8?:Q~`fҿ?,eb֖݈KnJ??n~Bf?yMK{?]~UZy?͙TtvqIfv`ǏqWb]J7z-Ƒky2>yby?K qϐf {'p($HNTdK'3҈-?˶QQ*ɫGi42]@V;YW }6h?D].jrh;[ާ^&&5c@Z͏e`i ?xgRviu"qɚJ;ߚ}ϐhZDrǨlnniSU? wG6]JrѾ(mQ~͢j7ŏjz/wWmw{k%3QBPG?s~q???F(?#H&m1.|]\9d-hqPٮ}*o??LT)kD VAfGl'虪t]v*UثWbPce}\NeAXxDMsLd9{Z皗FT͡?*xڼ^%sχ~+֛ JDM x$_B~[G?q${`(Oª:|w0_/'?I2s?s!v*^f?+Rnd@ wf+\z?F*?vU^[c]>ffmo,`XiDfFۍTy3aO1ehueS4[s*j6*&?z_<m5=B_ڃ7?8(Hd~Ey~YX7NmNmd?Z{~Cjz\jZ03HX?8ZI¼X?Hcg?t=OV?vMa6 :b%?/|TrX?&?MSˑç`'%b퍭[ܧu*zRb4FK?_jVK "0D늧V^}?ƞPo5-Ne:?M?W$!xdzʜIqUߛ? ?i)???Wƛ?1|UhEo|}bmoy, }2ӵ1V;5yȿ?>jm-pAnKQNg}_'yzvc^jպ`[aVV+H,| ?f0PlUb]bhO?qA>|zFvkݾ'|?߽h:q??ݵwN~qWП^m]CNΛaY[mیREtt*Wbe_OO F&exi?Գo*?-FbYԒ`????E]v*UثWb]v*UثWb]v*Uv:u? kD.=G?d2dhe?}R?n?{[Zֶ]?(Ei1Js{sW spͿnZL?r,'?O1 l?zdbN#<@2=_zv?|#???sFAҧy\Y%??LUVDŽ y#nвNz4Q3.?h?9esG^WYpgf?Lzg>[Ѽxt[?wM4sz^[l3??ilP ,Z qcՓ?cWb ?? K6o}k*Io9\?jPkצ*?UثWb]v*lXg4?}G/^K?#LʾlI|iL#Cpj?,֧H#_̯+E?'}+@imhN-ň}*v*U][MG-apy/tl蚼@4?O)a 0OyBhW[?fbO'%VDqTWV?y{U?N 9k ?Z|U?0l~X}[zV*UثWb]J̚pӵxLE b_Oh]TKIE?tUPh9-N?j?LzCt3?KJO`^[KΔp^EQ $Cɍ$?j@Բ%w` e??8{i~d c.̳^݊v*UثWb]y濑|1[\~]ݢ[?XP`ufYrD?s?lLӉۚoc1jY k-?؅jOSGO8?zOXpsvk?ѢntҢD[WocߔVnƳkXuu?(1Wb]fh$X\G1V;f 4z0?bDMJlK̺O???QNCU Sfta LK $d0ʔZ]^WUjmTUA?}ic|!??Kxi#8K H hj{ U/k?~dyeyt-ttf,-A/?qT]ף6!'L??q7c(??y͖JR}֑>)Tjߕd8/3h1ܺ$ie?) DNb?|TKta6vT9In?r˫ymnvAFc&OZ㈕wj4Xs׉ʻŪB DqSd??|xcÎ"1 ksWb]v*UثWbZfURB_?k?I'?Ll3:Xjivƍ*;C]a =ƑCvY`GK/-J j$srQB55!IR/?V?^v*UثWb]v*UثWb]v*UثWb]IV6Ch_n?ˆ3\ift>:yk%gpn?/ʤϨɂa]a,K F5>M?͝#Xj>c?IdD P 3|g9a^sˆS@wR|eoʝ%V{7?ލp|imd0?–sb?S^|kGz]Z?Z^v*UثWbXE,l??WUO.,;` PzNgXj~\?9PW?ЊZ s lUVꚼsJj'_J.[*}^^y~okH.VD>?Ҽ^R?|i%YC(O;\igc?.̼~]T 8I?aeiu}8?!73-~??)O7ں'\y??Ud ?Mv،U蘫Wb^u?y?s?\UثWb]v*UثWb]=C[NXghFcKY?s]pLd,eڇ^Ig[]OR $Uu䡅ARU,E{/Sp?D6h9q$2xMC+  p1$cd{I}kl*e<hkcԈ?w;cK,<\<'~rhnvcq=qE??'ew+e9g?À? 㟪Gmȭre>A?֋Oo}O{P,q hHUF^ _ FtLEqjf9b{O{Iڟɖro׵h: K>]|WwdPGh4:?Ŗ_Tn?ǚTp Vui}B9Z҈?vf >jd%RsF}hV"U5Ĝ?QfM{{Z[9rFZSo?w?MK~_bG?0?:<?BkzZ~ON"շZ/.ML~}Է???*?w?M~g_ sQֆl?gj7 j L`׿>'?z U]k\֌*?_c?NɱU 2~zk?JԱByk?bykCZ sn%nHvLL~}Է???*?w?MRNWLֈy6pVMm 1TK~_b1Rߗ?sdتQ~`~tjz[ykD_nn#ȶ⩿Ͽ?q;&]c?NɱT?1?9yLykD?ٿHz^K菋˵1TK~_b1Rߗ?sdتMb~seqݽMF?pWi??o??lUߦ?>[?J<ѠɥBڽZu5&9Qv⩿Ͽq;&]c?NɱT^}ƃuj^Z͕u?_qMc?>?uށŀa]NYTWߘs6cK n]HSqVQv*UثWb]v*UثWb]v*UثWb]v*UثWb]?ߪچbjQ?Z R9 ?R8,{lU6gy?˶wK4޴*G?jG΃l^_Ziv%?hY^#{B]v*_kqW]v*Uت^?IԮ$<~)?!b1gcR= yQƜ{\zIA(Tg1A]tsCzhߚO?~v+?G$+kov??PܻJ? |b{GAK?}fˇU[xZn g?VCg?4Bb|?t?Tî0.d?s>fGQm<2W?l?*􀤶Xw"Pr|HDO|19OmOd'/?im#ɫ̷ܓ?+ƕ,1=c8̺?ڌɲ˕&L2HT#QoXOUtM38vN!?)Ԫ?(tUos4At?3#[!/˚om7RV٬h )gIz=sW8D:\?zXqșnnȽ{Ht?!D?քjz˯\`1c e?$e Ye瓮V-o?ymlkJ^A{vcG?jcb?Dz?Ɋ~cRkG{sh2#VrH7-fZYS?>I*t SykWh|z_$.neA|L '¹x?$aoχi ȦYb]v*UثWb]v*UثWb??-usTe-楩]Ip?(FE (F*?B%Vy?bq~dIlۃ)gUx?W]v*UتHbO.?&U?UBN-twl%Pޜ?(ZdmQXT6wvW {yT::ִe;!#EDQUQxxddC*6VV 1U-;Nl`?lQbBh`QT&izM4Xy?9jIQxT-Z^_Z ѽ(3D?̌>E{bUتiX՛W Q{z|1T^*U siw:qk?[PdN?n( ㊢Wb[?Lٯck9ȡ9%z2??v*;URn>ZeE*P?P?Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWbX?-|\qյtb5zƔE Y*h99&> xH̃sT`}j?xbORao jCoao!ZUȖyJ  1Wb???Wޛ~RҤx0@ci; 4p۪cJgzvciڍqeyOm:nX|X 8qWb]$BëiS? eo*3- b@?U9]??֧uLWŎهq>켚Oӊ?TmuQ5]rz,L_?lҝo?Hr鏾\]FZ^ˉyO'./|??yy噜^Tb]v*UثWb]v*UثWb]v*UثWb]v*UثWbZwTRBYu$67jiq©?NN*v*Uت?&OQɠ_7UWb]@k?g\k+7uYf qiWb?|)hWt}eDQ?bͽ?V mETYrVb=cV4ˍJZ?)Ԁ7ff (N*?Z6UfIiQQVM40BL1y$rUTTN Uy?y:Uǖ ơO??Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWbR;j:ZXjjHZ^?]E_M?]w!`z'_˚~yJd5)s?Z\G?l?b|[뚗/u0^ہg?ı? ?~bAXOfuTySb?ؼPȿiM\U(mmGuK,RYgO|U?Eԝ}-TӬw?*\$jO9{`7ў1jF2/5?Qgj:M"qɽUn´M"`MN?_lr\RR]uuiu5?Ks'9YzP`ي"RO>?#CyrkQO _@፜)DV?#|m?/#۷kVx/F bn/?9<ϛyWO^+>YZQBq=}uGg?Ll2xBHx5?D ?;)9d~Y>~xwߨrtx4Nc/6>kN m3RjwL v7K ??CW?dgi xy.8}aߒ\?迟ߖ7TJ(k)JMv O } a<1L.?TA] Ʈ,m!|g =WQ5?̸vA'|GE"?GI}ha̍Tnҍ֣?z|0)qJgymoڌm:}oONS֭c Z?t*w?^P?F-\RX`d?x=ˍд`u"{*(X,/oT?/?o0Dj:ن/C:3սH6>I?GB?8G0}ś_wy=z|Z"ʓRVU%6r\)ywJ?Ķ_IORhfIY?4>]v*UثWb]v*UثWb]v*_k;cͺ?[å5AQs-U|5*cWkyf|fXzZJ?Eԑy'?nIqfJWlŏ!P>T[TGno;znm?#z:Ń&(ñUyMO,^pUaB|JT$Qqc syc W ?XFt;PxX 3UjCmke9?kRLUFo sR[?H\*Pƻ^a?yH?ӾB??Mݦ}ug YmY$D,Ʌ1WϳE̺~cMfz̞Nb$TM??mVgoo1IR\%?HakA?'ۨZҽWb?m|M3R[m3Sh.BzAhwژ:K?~h6yn-fZduUUzkE>?` FhHQJu-k% wfITNU;o?H?Mj-U6`A^5!{fiڮwctK{X::F*?f=*ʓ\?Z׫lj\jqU?;~tϠ?6Z'_4-Qh\oO C@ VAk +MXE ?E{X?M^LkkR5q]vZ1U`Yyw͞][=!H"_8od=͎1^¬H?ov*UثWb]v*UثWb]v*UثWb]v*UثWb]v*9"em\JRyT%O}TʾYl5fq hfҼZImLU-wLV򶙭M?5▭,PS{*ƿ2|{A6g$vsoQV󅖕8ZK?XEbd&^~CY}SR-_x.5?ob ,? !b?]&Cɍڄ3I0XEXt>?E QpY DY{@ei?!(vK#'?E)Rva] ً'Ĩb^V?-rmNK?h?^^riқW-?HWmmYf??$ҶO-}d:m ?QMR a>\IԗPʉHd?ߓ|dxcg??&?k"#qV cZkimPbx?Y b͗È?o?[-?DNPZȈUKI擬~ef̀?*?e?޹Uފg??(K[-?DN*u?k¤:2PO?mڲ?VOӊ=ղDG4O_^uQ@Km q0(4h?Ajw 痕BhE???ZȈUFץ^(FA[d]`$M q ^VA?i"#qWZȈU 徏+ ;XNk[k֕-˭h: ?i?hl????Hwy?vd^ ?JTe3p\ A#p"D:uP#ނ?FgQ? ?v*UثWb]v*UثWb]v*UتNG5kъ?9?tf?aQ雄iCP?G w1t o:mJ`nTWb?O7-4 DGN\VX&#Tb?Zߚ}_/էi KD(%NRƵ&Ӽ/^7?ְLQK4juRG|U_}ݷt0ծaNst;Ce׺&ߝ\?Owa{̮,cОB@{V9? yw]C? V(?݈zUE/,cwNz{?ՙ{ݕa% , xRvTF*G?N[5U4 ?7Dc?7Y坟lyDnCLݖ>!kzgϦNlbkycϤŕJЭWmV ʯ?Bk?_hYjImp?*jWb?{Y{ aPd?ڸU}?4A^v*UثWb]v*UثWb]v*UثWb]v*UثWb]J|ykQףTPiBgmVg??mPS]³Šiycz{??ʺMƁ{{fX?yԃ\UbRK?y>U?wϩrI ܐ#H^=#v_?qAG˾QڝgX?N{~nNlE{R_RaZhTeU"%e? ҃C^FѴKҴhDD8:yO?$??sHa;SR*[k{ig{a?Z %dP TbZ^iqM?!q3=K;+{ ,M=NY%GLUnDbv*?7oDu "%XxƮ\|W?h;_ϑq?Rݔ|JːbT?<꺊zZFj1Ҕvm䌜UL?Nѯ9ZUT0&u?tu?y?oaF^ލIYWXYA}e2\YƲ JGPA[yc?vu?UE?坵G6?huI~ HCzjۚ Rb~Myʾw}k yķSҵbA A# sGfmwZ/Fղ?w|R1Ơ=?bdיt_2薺֋tzuUUUe;zb*?g~toak{xeEcLѤQW=~U~J{F:?4Qy?ѥ?XT1]LUثu?3oZ󞫨GzhV[7??$$SBy/NwewsMΎ\2C$P|jw?;KHo,K[Y`? *6 U~|[O?W?W9BwRCP9X70CusU|?HW?5?ClUTwפ. ??? zs HzU?z.^To6jituc,4pDj7ց~&?iCE[[.XAk/´P|M̺-]-x??VVF`:ZWູ}bGi#Wڨ1UOfAṧZIjn5QV??K֝qW[_Y]"SJ?'V]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]Ak{k^~'㴾?ee!d7?V/w`VͧZkw[K'6?q,ceCΜ*E{Xd>ExcwʹAdfx?E}!劲o] ?JֵoH-Ɲ} m^Q8w=v#|UXU;x.m嶸f9pqe`v B1U@ Ubų?k:Ʀ4-"ZIw\R=+w?[4HFydVoeJn|U=tJO.h?XU>HlV;c]i?n+kajUmՔWg,t?ˍ*C|7PyQUn_3O($g/$O?{_J lݥha͵?1MqVk{tuF?5"A ODhP? qWyC%5H"\گaAN*˺Zdzj $}c:/F??NF.??%[F??B?Y4A?REo㊨Kj{׭4yt^A?6?H? =^@(*N?s?-|դޖKYgv$+cvRKӼua 5A1c>;X?C M1VG"Mgɚ0D^o_ڦ*?9VoW??QRQg RG@<W~^ʧ5tY&>BpۧOPYϚyGm]s h$($v%h?LmckXG`BFઠ[>_:*,^_F?rmc7;zʸsO:?UkMJrHtF*?|[b~e ˷&;Ő?^T?j0?g:6kRBu?~akVV3)?VꐭZoLQVRʊU^V bg˚m5Z ??X OriZ.N^?E7h*?Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWbf?|Y։wKCy0Ce ~+$n?Fŗ?I.uO9~\y[ԝ_?MVU{/އn|ϥVڅRHS?ObN·SO|$|~C~u΍?]B:ߕ<#Pۣ'KN?u DʠQNgXTΚcPt-)Z?֚j8C#֝O^?jsJ V+CO3hP`~??4sjq"jmTW?)4-睮d:oq*Z[CoAmUdiԵm3˺iVдj:8(fo?$P󗝯?˧+RXVʊxNGZUz ޗ\\@Mb[Fz ?,@jTi⨬UتD<䡫`hVTV?B^u>\~k?PP ?I?'䄀h[zWb_Zy]swi[zVaǐZubv*Ŀ0.l<iM-k')~>*W}UYgikl ⪣bc?h@IWbX矼aM?ݝKa"S^\DmLNI cV$ĒzU1R{[)[jQDyD?,O?Gъ?Xg dE=M ?]kmMH\9U EqULUثWb]v*UثWb]v*UثWb]v*UثWb]v*Uثˏm'MЭ??ݭk_V agIBzv?]n];KӬ|/֧F?[/!سP:䆛~Tk>JЮ?^ E޳0>Gf?>ߜ?WFIgd-m.Lע7 ?P 7GsS? ON?m#L Wڋx&a9SQ~ckRiFKi faInZ!?wJ׮*VYּ?2Mh|V.?'EfU?3?^>Tw?|J[?蓫۴H¯^-Sن*ʴg 7.WryoL"e?7?JLUyv\dkiucƾ汼tjzh]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]oJ`>u ,-*I,b?t疼Sc\jVrܼXޖ $?q+ ?WփΝsLM?.}){Ri8ʠnw'?U:O祅m.d?,6wCw??-&??V{Mկ>~>f?ڭ>gֆ}k ~K?wY?vLm\|Ϭ}cieZӿ99aL\UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]:pnbMRJN?Uh)o|JPUZr)ȍb9??l@;ק!Z;Rzbr?\?FpWs y))N\Tl<1URq+ԍlB\/Qצ!\*wwnj;\NqWT|ph2۸[V튻c*@"l~45qV?Joָ)4U6?*N5|?MUUwqWCOqJol ꃷJwVFu¬Fd]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثuIS*u:h?dpӔKQ?? \/vVuC??izSm)ʜINc!:8_ia[@1U*k׮zmrMqVQZpJCr$aUEo?WV U? \omR-cnVN?MLcl1%~f?bu!ݶT5gr;F# q}gL< FkI+{jbeXH@ {,Hj07IE.IH4<#*:$QZw?r\~9(?XxP[[|[?nkyIcp~tw'q˰iojrvO@iy̠u LSl yQ:wd@)FoZQFZUv,:ryWQIa6mɍd˅j:|F?ܿT>?YGrIF_4er2B\s-|#'?qM0E͡j~ܷx}#$RI?Wdq8?-&!ې[zչFXdRfPDsF)fts,tUE2G$R^Fi/??Ň~@NCdak>rV!7.ۅ2g4%n֭Y$fnq5zlNl?V?~bRn?¤JR6ɍLgK6)vTEO?Esn ]ZZ|_pf423OpI p??y\ ??|fEDҤeHVOYoc z;P )%l6 'dP}+IrD;ٍBC`rxʓyGC1?=~ZrHE젊~X"Ym? N0)JHߕsnC/-復?e: fе?nrZf? [H\_GC ?XU`nϞþN~^g?gnv?\ {bUy7o??*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbw_m|F2,$uf?wոԭRPhk2OvtumIjrCOBqWnT?k?c`^NCڡV!8׮cogyL?S?,?OcR?^? t;)-$E*Ǣ@ĢF?SP3`T6zէٚ٫NDF Ty p+\~. F?kUlz\iZ? Wb]v*UثWb]v*UثWb]v*UثWb]v*UثW?\O?HҰv,@ov*UثWb]v*?銥)?*=j 1o̞'*؞@WENz" F?TCFSЌUiTj7wz??  T^*UثWb]v*?2Yl.rC b[qYeH?$?s7v*UثWb]v*UثWb]v*f }??ca.~9pcMԧg&gH?"ˆrpռqlܸZnq|NRP U?'"H5~\N?DT~,t?UKAUwp+j 5'?USkEX*Wխ J/_ zWO|!Z?zS?W]Jy7|j^uռ1\-n-bP?}ͤGBI^zb9+4l<գ-T:%?RoۯT%TyiQO$HI?<k<0*~R]Q_??FgYO)} ^qZ(y6 V#吧F1]F ?UCم?KOU`?-|Mx-``4G!+ߊ꿘~F?}{̌Q8(i?Ǣ|?<[^AA]D hwī@^PS?qbv!W+EAj*qZH|0+]{U?z? שī:`Fo%OqWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb?˽ PaQ[FmH񈊙?Nk_|Ub]v*UثWb]v*UثWboVִ#Z,0s\QĚ{U^X>+_2[hi-?y.dGY 4 ܞTgU"w[mnhUIۭiSjcxVKRn!Yw?VUxTz2z?3ȠJQZWJ.<|j+Ke,?ܜqVKv*UثWb]v*UثWb]`v uIpH8!;} ƆWƸE[x?e/u_ w'[¨!?vƁQ@\BP;v8W^ث{ Z|U~?l~xki{V?'lN؅^Jlr*b Rh|[mQpKur껅zy(S?r ( k 6OK+(VXU K;aT?#yV3"hRF?Ye[Fzב 螟ˁQ:畼C!2JI?U˚LOVgbk*A)CI6H4wtҤ5kERE=M֤t=U??դUj,q4}ǥwVVD --I\!SQbČmT_?Ce q2?IoWSv^GگLmQ7~Mީ=?{hJG@oh1Tqd?W kN?Ui?V?V ۿ\ Mk BGW;}8w¬ɠ~~?OqWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWbO?Oϩk RJ*}I ]8Yf*?7?,Htۨ h^Gz_]SMҍq}NxðSpwV=늱o1?\ݼ-sw=Κ.B9|j~R̯-~U^?ѿ ,oiz1h?%gUdOIGR-#/Ҝ?I}{^?T^*s:K;V$g u!EqV3ia,~[8 z3?OHYV*UثWb]v*UثWb]v*UxarzIOVmީgtb=r,} &BTxAQUɇS?]ࠍrybx3xYIB)̋`G=Uzqix_W4[;I_WrZi]{l{SZt\x{WO]TNվ?Z$m^6|}U U?v"0+:W|4jң[tZzoh>~8)\U??Rt®V?ni[SHa a+w®XR\HVgL _dUثWb]v*UثWb]v*UثWb]v*UثU ([Dd5.? WTo/?@Yc@I? jUFݮon#JgXTUU Av*UثWb]v*UثWb]|eWf]94??^|8hj*?oRqW??Kco?Z?Gr~bzԭg_CHvS??yP??XN*??8j뻃v*UثWb]v*UثWb]v*>8M^k:ipWL>"z-j;wLݏ]WVW?s1˕t6mRN(hyii֝fӂ* ZdIbSֺBTN'Q%@\yUȪb3@>eG,VcGDknXjۯ?qLTo̔`>d?ubpĦ} n#?gcр"Lj;V5k4Yo漘~[V:О3IYhGFX5=c?v@[?G,Xv˷bIȝTKnUUޟFuAхZR`WL!\h:Z;}H\ZOSju\ uJ&S?ƒ*{]v*UثWb]v*Uɱ5o[V(?b???6?^&N^\UM?c^ ^RӹkJ?@=銲|U󐟙ג]=.Umnl?*??CUb澵/;C׼__Gi.Liz?5?銽v*UثWb?*)f!Tu'a jU秚uKFnɤAqš>?_FʪaÍw&/3kZsw?r}d??W.̴Gy7?º׷` Ŭ?4VH?㽪Zzw?}<èfw>]ɬӀbf.e@y_7ijyBu {GKw?&?2Ic\ËW~|U_hqIBu=ԶMgI2F*|UtuOpj1VWb]v*UثW#g|a?Z\Ư  _V]ª?D&bw^w柕{?Sn"{+y-州 rw伤OMAMN|?>x?}]?䚥+GXQ\Uy\-{WךT0I@F\,༈]8G?(A?]_q?`RUw^ъv*UثWb][?wO^M8ȮO݈xc]v*UثWb]v*UثWb]?7%N~B[xoDjNvaWP9NEJRSzّIG׹/VKhZIۓo?qL?mpӧOQ mnM+ap+MPjX~10:?.4 Q?$[K?i P^I#}y!bh)?Ⱥs?y ێt^eyۙV)WROn??P6_YUSF176eܐ^]{OӬGS,?J ??)K?⹍6 +և2gw{ ø:}U܉; k튵Ȓyt턫8\v\I=>U\Woۧ|V7*1^E?+??^"&SԍT-*?>aI]^P?UjkV(UUOy] _iڻa#2[;KT?kx D_?{ 掋n4[uirC)#?r5VqgzUm,Ak p??@iQU= J8z+uM?Zzj[?%qo"ՆJJmf]_ڵɫ JVcW=vUZmXl*|?Tv*UثWb]v*UثW~hg*RL-qh?#5|Tb??͘?ȵ['RԢKZaq2?v qVgv*U~UֈbT]R<od`N*Ƽ^Q|y?O P?"GTS- ]#EO?H??H\U5hfA$2,0bWb]Sn- *2:˜ kn^WY 2l[eί=צYkַko aqH ;~.bgv?Tյu rm. Y-F f~GV]W~uy/\?2^[xm[ BG`hdt{?䗛4izè_ipZk?P?j:z?v*[M#U׺i2rӇ-W{V*UثWbTXJ?^);?e[޺#,a?#T{P; 늪]v*UثWb]v*UثWb]v*UثWb^}ߧ+>m*eI=)XǙ|o̿ |,?OīJlE8@B:Nƃ]קNm k>{vGSQaV{b|U~/U} ڻMI?XygVo^R詟|u1uHͽO쀤TnF cQv#?КwUU?gXr#RATa*MOEud]+d?YJ+q'TW/݈ЎKy ?}؅D~UɭM-Bi+E߄cJA=;hUZTZ=?`6*>[v8Nc"$?1Y{+ƐW]OLi\6|1WQRv?V?ZY(T v*UثWb]v*Uث??O?X^yRM?ewYfY3ثOY?5Y\·0?e24Nr?lU~My_Z&{?e5;\Ic?#£z*UثWWZ#_ҿ?Sv*38o4Hϕ]qqxжU\U(8-.7?BN!zl#1V?9jZU兇宅HjpjC<II o* ??r^ꠀ>?YS4:> MGSSYXГ˭}TʟS~e/ͺn4u$iɎ7WMWb]v*?=mGss,TIcAqt8bx{n*_/y ]BH`SG""?i|U=F?nrh;?ZAkB D^ܒ![HFVURM|U~*U?wt~h[q,Au?vd@AE&bh]v*?bGRv늼gSW0\SPJB?  ㊼g>o$yRLa2^${Wdrw 7ďz8J&9E ? iWz-.ԟj`h5.>m\&0G?q?,+㍫Mq^$Riʞ:O|AUިjP]UWpFD~do/,l?!A?2t48]?GbTsэa{_@?9e䆪hvKϔ`Ӵ&k?#Y p[i"g4X9MgchbmA\vSBWVnмikNTSBEh* UثWb?G[z?U⟗pEs>k ?u=lZ??rAMWXH??ߣmbjlYGz?U6&Yot,̔Bb$wU[O[ͦ\,Z?faȈ#ObpD\ܒ~eO\8Ÿb???t:K{K*K '֕x{*UثWb/,o|?/ /0?&Dg?c8 q+O*?v̚>%IFo1H{YzXb]v*UثWb]v*UثWb]v*Uث?95 rpyf IIo>._+&@ZރәQXI6ĕHㅕB?yj0RvֶQ^[OёeJz .?N ^IQ2l& Hꭷ̈jլ?y M: ˢ?p@48>` ƥw唝DF(?ǐG {Sz? ZޛPb Wf:کn24nC #Y0im<Ʈ?})H9 mD$rkV Xmp*[A㊷Aƕ J@;V0 M*qo iVrj`k]Q֧hV{~޿OqWb]v*UثWb]zh^oQ-9oPW?F91F?/P'x?O ژGTm )C`E2EJcBc M2adRZd$u +LdcO1]D MF\5s_0kſpYG\C4e=ǾfB|BڥDz?6-7h;bWlB ByT}Uqv]Wu&N*t=??Tv*UثWb]v*UثT^Pmvڜ#e[_UvX~K$pI?̛d)bFд]lt{4??[FܠbU_MЬ4H/6ztҐV[]Qi^潱T>mu$ڌ=J{N?KjXoG*?du@zr ~U~RtoԒE*/v:cs \[Q?%䧡Q]f*3G{agKnkZdظЭH۶*Ѡ[nz+d@?h?Jߦ+\UZ}vq*?AG\J&tj??*UثWb]v*UثWb?KKOeqz?VE?P UK?\_Oep?泸Haq$% jm^0_?xX5变uzȹ] K!n¦E#SኧZnu?ܢݔiG?8??lU?奇ߗy|yY/a]j% aɸjW' ,Uk?j$?SQ,q0?o.}G Em?Ft `8Ǯm4?8qHS\̃v*UثWb]v*UثWb^q?J[Eo_lamEm|$ч}i Ӝ Wv?UkP  ֜~w#,?UլX [|Zt?_?լ/eb[O?'NZ~f?hwenT?2cYNђa?yCۡ0w̘d@inPncuLU?ۦ)lSM? \J xb)ZTW@" c(~LmڳtZLToPQ?ou ?&bSUu+asGsT `Qm{07)ks1R-I?q%VyBo?j??JG \JyJ ?- h~]5X;?n}H/$Fx ?q*?) MF*ZXr; ٯucZdZ@P0:4qV[ʿzV?lUꘫWyS[>~fiz}[EiR,#QӮ*Q'h{~8?}=ڞbjw19|m6ȴNlҨ_MUgԦCiۥμ˒}[[t?sǚ?*ktbYmK_бBa..M^[Pz~b=fҬ./?*K?q?kKG?\UثWb]v*Uث??[HHTwg "Je#U|?U?ȱW|?U?ȱW|?U?ȱW|?U?ȱV/8[]y{jWGa;Ii%??Fh?8?yf?ɥY.*?8?Wyٷ%1^s?I)O@e:o!']?QX~?'탦E???zR_oS8?(?տgOIl_0W?ёgͱyT:]LIxK}7 mNJS?}[&?^b 49~`d-\?v*UثWb]v*UثWb^s?oE7~=RsIx$=6K?0 c2s]<2?*32ԏ?f? 7L N?W>A:PԚz잀B?F mBIciS⵭z eްd<Ict?'?X/Ri銯GLT81;[֠o]ޝqCt?+ V#ku?*=8?d8Mt?l? J] &}4}[G o-R#*)U5?7?Y?dB᷂oCU䴧+1_zM]YF?smF7n)Ў`fߓ?2׵[gkhmmt.?GzbN:e*hZ3^E$Phj⩤Ua L#??1?JSkk丕ĆGU'^;-9~n?,fF{H'쁷ywuM6+ο_y0r?\%Yե&KIVMK\2? SFzVy_?k$?0'z#u?vEp=Cm2X-Թqv#??ڴ[fjI b m?'?Uuڟ?]ZБ?Iцd]v*UثWb]v*?EApjߊ[_?/M.%]G$Q^!k[W|U+C-.?IqU>¾/|ߦIq~h}ċ5V̠(z}bA]v**DyZWEWb^+u+4 RքzAP"ֵT,?rkLUKyʗji?WԖ?Q~(ji**K osiϪڰ\+Rl?[tg$lqUY$'KMFno?/1?BP(kT纄\?FBWW[?|U4rKH N)̺ۀ7JjSUH 1銽v*UثWb]v*ASkL?Rg%P[b~ =:֘Sn?k]n?k]n?k]n?kR>??7?X6Ac_U?ZԴ[f>r3{&C/!Y:`?^r v?De"TG¨ ҝk\hp˛?Wb]v*UثWb]v*U~z봦P*V?jhFݰ*Lg??%nrŕLO(fI԰S3ކ_˭_IE9?ߗ`V?jr`sy+JBCL}qc|fQE9h RҮߩ T4k׾i\W?mbv;_W:N=a?>O4?>ם>^] bW!Кƫ?gޱ]c$qKo 9`efS}o??s}sNqB?Kx =Q=?E[sd ڜ1W]yp??@ iiE??=¯R}JcWf $?}O>Fэń&v^G?\U?y5FE? K[n,D߱8*?mcז] x?dH 9$h½: ~ebмx?ospE7gѫ@ī:izE#R$znI$ UB ?]VѮfEqm 58UyvɿZea({\FVr4={aW?{}UlqW|C+U"qU_8ߋn ^_vī?3A_!_?z1IRb.WK*+47{h?rJJ?+ոGn}?B#gFk/'^w6@>K{.}H??Qd~ueB?K;eFN ʊӥkx|.ou.]v*UثWb]v*UثW\놟gJ? Dm^VI]x^[uahR)OI{l{kEnӇ#?SÅVѻ- :\CW߶i#|RVC?~m[^UuJ֭~A^gH5U TyIl-wf)n%OlU3,m-EQ] Uu km_NLEq c]LmUt?e̗V^?w30hdSۦ*%ܗSP٣xQD*Pt?ޗ'MK/'瘭kǜM?"{V?~Bc cHn}I9S~?FZGuo%ZAY{UH8Y7z/&Y}$^TQ˵vTkkn'devCUtuDHS͘t8[s[ƶLxSn6?i:\ZMOw38C$1T֔pׯ|U?oQ1Wq TCq!]GbUy3a˯??*UثWb]v*UثWboκ?{{??ysk$IA:lx?UG^o6kfgJv6l-4wPp5?bzእ>XRJ0}%y*"`fM-JWeYߒ|w蚃\O˟M̍,u֕^Ie3ok鑯GIo@(qWǭd4̗Q>9U UNdHӾ*矌NZ?SnEZ)ݒy9+LUCGh?N~H{K2à1?z\w;?3=>3}{?YV_Rs+V|h>MmHw?qV ,ei?*ӿ^*Zȶ4[ hZ[^42I/u] ??zP:p;/?u㊯~by5[HiI,6??D?bWb?{ q%H?%΢H^KZ+/VO`lUu?gdثZyɱWʵ?|bc??X̞twkY ~nCqVyg?K\U~pOn?yיK?c|?Q0?7L?R˯otLBOGj=lK-?GOo1MgBw?oIQGqQ5UΟqjcڷC۝[TXsQI'/% @?>W7h[ &?SdZ:h|RP" PWjc݋ {?iI{Ie yWQ([q=c?ed~ӒfwQQhK Kcґ? q@GIA-kOi$jcrN׏l  ?|\}H??kO[JM!ig?hUd+??Wϋs\?Xv*UثWb]v*UثWb^Ko0?>3fO գjrruwO7b,2UY_ 9T0H un4Nw<my!.6mϽPgz,jVhEIm?0u??YMک -?QDiκLu"Bd{>dB y4 ?AIe;|?Oi'Qognۓ^ k4oW~{d?<;_4ן?@du``p?yU?X?0;5~i@I 'L0;Oosʪh{mpTSzy_HjJ'?~;?0_]ʋq;˹Qu[ sރ]~̚ =b```B*wq$?ph_T?lZT |HQk@E1?t&kN߾MDҽѼVT(oZ H?-F=? >?^ҍ3< ?@CCi?~c+c|rLh ҵέkHڕVP4??oZS?Uw\zV?xt­(kխ{Uy3?ÿa Wb]v*UثWb]`_@o9hkk3IIfP c2]V?~`I5jq5nBٶ늽 >Ra]W}NjZxc>pׯa#)@qkl^Ȼ??U?ִ r#J {}?UbHmpK#rYrqW϶^PK1v슚U]@x]WSߝvխl"LP[j0kSђH?Uث?/awΓ H-%x̲N?LIr,Q׮*u&eҟORP??.Mb n?O[?T}#RZ+e{n0DѬ(?n/WUW[FgL6,p4f?PH뺮}:~?W2B`eyޡO?;R_M'Q6\jTk[?T ÜEBm]v*rZH_jޤSG TZO#^0߳Qf?$U)OLU*U󓯣G*MlFtTvژr?5_NSspC?Kwïߗ ?Uߧ?~_?TW~?}RR>y/ZADZJ4Y}n? qWYmb?lۏ^uoH/L9~}?n2??ڿOo.RlaĿ?Jv?_?qн]a)O?@a_TuQv_jq3}zZbr?7?(vkRvAƩ4Gl?mr/Pk?+}x| b c)bo?!Y Qq1_5R;{(Gv Y(ӖmcoB4[u_X+h~arIyʱFʦwHF7ovkh5:ol[OpTWE,7o SۄS_TmWd]*o5) !D?lF?Oo?oz̶.]v*UثWb]v*UثW?YC*VnNE_+U?Ok[ѯ S^ pߥwp ?BO_ծ?ҞtdPyz?S{/j_BO?EYU!sA~ҵvS ?[?i4rcFOS?ӯŅZOj_N7&aqNir#lk~?ʥrWKj? oZW/q8r?O ~=Jf>Km kлz?Yn?ʽLӺ˽iL%Z<ܜ[\ER9W_vrS\?JKz?Y~T~?g`Ec? z*N\v^Wb?+{|k?}OGgG־|~?y?G[?o}c???EWoz?k}UkվF/? >_}W?X_Ӽ~Z_[z?o|>U-?o??? bhWtWSgW~T_o^UgbU]v*?8?Wyٷ?^yoٶiqVKim@:?I$o?q}?tɒ~gSum?P7NHI_'E?_zH?`s?^?m??:?? o?y[-CW?S??~Ÿ?~=oƛr?h?A??YOY"?q}-?_b_u_U@}CHr_2#[^K?i?CVouk_}??s 1<4+z_]y~vi|ÿO~ c_^iDӿE}K>Mצٸvom.]v*UثWb? endstream endobj 62 0 obj<>stream ?Adobed      ""E  s!1AQa"q2B#R3b?r%C4Scs?D'?Tdt& EFVU(eufv7GWgw8HXhx)9IYiy*:JZjzm!1AQa"q2?BRbr?$4CS%cs?DT &6E'dtU7()󄔤euFVfvGWgw8HXhx9IYiy*:JZjz ?N*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb^U_U᲻=Ua"?t UO?yNyCNH#с?T][jM ZѮ\GXv*UثWbVσzTCǗJ;b?|ժZ0W!Z+J~"ypsbT]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثμiZlQis[QjiRv?~]~gkzK捀?we}8ԬyId(?Oث?"CjAAb?nuy|?O߱ <~bZԭ?9[_Ymzi FOj]Mm ezo,'z*oֽ1TݪywWA4YVP7?bzǜ|o3f jKt?SQy~Ӎa[z/ӪV"8.|OX?i q{m-EE KƈPPq] Q_|hrjZ'4e>ɹGT(vw=qVMe֮(K򅥟5AHჀmíi_unu]6쭭̦4MP^]R_Ix½A??-o IwHK)R6 F̄0=G⪾VY?)٫C?k2f I?㕖:*z gWΨNh`W=iMTR`D?xͼ*H? Uٹ~grU?YTbw۩[̗wQYmcM*?q]Ns?tfn?ʈ̑_튡rYeݯm?DG KUPNtڄ6[dp$r@Lcb:1Q?%Ԟks"2z&nIBWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]i ƀw8Am??idWXW٬]y#rN?aq9?1&w?ռϦ{nO1am1 ^E? Tn?K?_@kl??v0hY=\U?7YMg6ad,v3?gU?o x?B#4n\k?lUثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWg?z@ȇЎ٫a?yS7hi1f>?~~OZg?O?KVORTƿU?<M&n j#thHfU?G:f eH:srPi?rMo[smƹ⹂A4w(TBqWf~P{?&P^߻K?@pfZ0Hn4V}E=dPz=I1T~lҼo?A?b|FUfF?+ r?#<((xJTOݻVA'e?Em,qaHܶgr?΍/E^Hv*?$@>[`E&мCp+鴼GơF{TZޙ_jZX`uZSlU^mxrb[?7sBv;)UN;?v@rcb&/$Z]_j[gucɊ?uqqTR艼L?vK34HI'?+iy[Ok?S^%-ۭEqU_?׶JӜA&nGok/ UG?)5+ǁn-An }?X⟛Uh7Vuc?ދ{qR??ny0E^;?@ ??Fa@Jģ?0P^dGQFZz\?G"vxo坿כk?j7o-?Ql썈?cv*UثWb]v*UثWb]v*UثWb]v*UثWb]a.?Pl?F ?M?@nfWbwͿ/a`kp?ˉ?.'xcy bJ초V?HEET\5JVhֈ6=V? Z-k~s#?_Jʾ˜VmBE>1f{VInHIq|UTߔ毕?y: ǐO?>* ׾*?ʛIJ U7m?3G?c׳?Vf H"+n|qUߒ>bԭugڬt4M!? 3w1ToקyGԤ4[`?kt OU?4/)5?@(ʢby-qWXWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]iou-5[IJIVGȌUSA qo0i|=9acȼGθ?юs#_ktV;U`eع|MqW~[yGR5VH`2 $AyrkY\Z51ʅWc^GS{_}GU?cN~ē V=?UATkyVڴV? ioYdCU`>]v*UثWb]v*UثWb]v*UثWb]v*UثWbPꖰ#K,EI?E?y22}k?3XZI0 l?7nd$ueu b @NCtOQ蠚/#ضx_O'|𖆗 dISPsguq\?~*M_j? f?F⩎^q_ 8Sj-b{ ORUb>/O>i>vVܢ!MUY_CZҵZu|TW^t@??GzVN^TZm\UZtMS]?KIzH^8 O2R_=q[_}cX獚%ܤIrPMӋGlO_??%t?I)9ҵ IYb$#`EGڴ_7 -4^j֡?FR~&^GXM?U~#EWcЍ늽W|Zwsi ݙ-AJrTZbv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UڝWGVUi_-kg50Ay2r$uYYSҎRXfg?{?KM'ڝֹVBCZP(zqLUJʽݏc}r8bQZn?(}T}?bm?ڵ[?|bV-dGrjjhVe??WRHTBc vDAsjOت?fK]+S1H5(c~k?@hX\y7 _OGNG?VS?, ثWb]v*UثWb]K??t PH?]v*Uɬ UiS[ ev*UثWb]v*U!󇝴?>"?F0i"kP?TLX U$tz^,`+Sשتpo! J?WmR?yOUz?H?SUVwyʷuh SA݊?\|?NOW?J??py??*\|?NOW?J??n [rzHg?M#Cҭg?TTbtiH?P\UNyr̟TύKs,?a, ??aƧm}/O-kVzsnd?? 0f W]v*UثVmG^M?m/^CӏxOTQT*kwQI#Z3v*UثWb]v*UثWb]v*U?`@ oAK]=HaRAABPnXAO6G9qr?>4wxk~rSP{?;v*UتUo5iW}OZK[Dػׯ`b{+?.kln\A,)5zzo"*j(+S\UثWbWn`bm3U~Ek4KS.XE~UثWb]Kz+vW ?|v*UثWb]v*UثWb]v*UثWb]v*UثY?c.:vޙuoǒ]q?OT5a_? TF) ⛅f%aFV=Em$&6:XOsA_px?;TuV2?͌q=3j???[&܃[WZk>ieM|-IuA?K2?K%x? 'DS<:Ǩ[#Su(M6*U?>@nZbߒk*n]m*$aBT}yI|?Ga'mg?|=?U:ΩjgG>#ZHnY r?Sb?nO5JlU-?S?IM?`?Wз'L%6*?Y^˱?*??M)ܦBxw_Rb]v*UثWb]v*UثWb]v*UثWb]|eKeOtC;5 C+?ep~*~ߦaf'?N9ۧ1( 1,[Wֵ"[jT yسY?*k?6_3v*ԟ:Σ%yv]6?Uy~n*yGQ:-P\XTtE =Sz^*?j?kzF}LQYXJX珕?]z6^$B??c?Z??ly>4^s?z^Cjz|z??੧*7vQҭ?8Rd!n@φ*]v*?]-?Tp?K(oOu?v*1a~XXӼy?ҙթ^c?1VRDbux ; i^?XWb]v*UثWb]v*UثWb]v*UثWb_5?YM)r}.ܗw|xOd?¼ z֢(2LJo dzg[GH-Jr&xxGqއZYA~}W bAUED?{c9Z2H˚{;|y+˺:[9x'F?*RL-MsQ7|iTFkfbs]B?y?N6*UثWb]v*U uZ]p( cO F?xn(cLU?pX?ZLU*UثWb]v*UثWb]v*UثWb]v*Uث}}ՋNWI;rTրМ܆??ݜKs?h 㖞Tv?2w(MPrXmܚC[N4/6?h?xPxz?pThn(בZК{&&!Fb?^*jsAiu4??YXqnGViY_ex>(?tw߶*?UثT."qW??a=bJ]v*UثWbտ?/cԯciUܶs ?`+˺A?P+/.NLdOgN?˥跫u4XB?Jq >fG֧isk[]:ۗ?? Vhkzw?΢iE`%cPP^Y9/WPzkYBBS*?qqzEop:p}ch/=FښW?]Iy4E??oM-늱}'zN1۫ $bct?58qV@P*I*l4lu?&?!FTUx-qVQg5O8s?z^v*UثWb_IK?gI7^YcH7jU?gW~j[??D<*/5$ߙzzç{'Mq{[{!甛Iht?ˤAGq}늬Ê:(F}5Xq+mjx{o$ZH^v*UثWb]v*UثWb]v*UثWb]ZI$?'(ӹlQNw Qi囹nVIH 1?Qt9?!uy[? I@{R2:זCQWTiS\ጁM??,)ac; ~64 ^y"d?W~nMeyA"?SþlUB MeeqF~\Hۦ*?U'?CsNޫ.AW"UKFƳzm^TsA#JSSɩ\U^t?mm]V[bqƪ[?4P qeKFm LaB2+z?튭s{wˁ`P@Ejz҇?1PyI-Q$MsqIȖhyqA^$p6I4>zkJ{ԚT1#W 8c?ퟔldyO=SS=??=keV8ĭ Ezҝ z,?~LGҚKs<vNկ?Wu8l0\?q#N%%Qh늽v*?4yiG%٠Rv 8e?#Oɩi$)X/@]CVoWb^r5mN^I Jf@ud? |\@?>7QWf7*E 3TH3vMUbFZ#f1wfڼ*Ч\? ??b?_3n~x???4\P^^?yT?~iʄ?RcQV&xs?z^v*UثWb_e\LP뷍oC??aTT?s*.aK|UoLSɷlU KE?}5wT?ʞIayWP*o?r?I?Nث?HhHN#PUX:KX?0[Z/LIop\/NEguS~cN?H?Q??b?seο!`?Q:[[h'IOŤ|TWqWИWb]v*UثWr?X[ϢyLqq3'׮:rRN mmn???NP\R8OTϣ\?[??r?G*i??E?$O^Duo#ZD[n?żaoU@lU:?_?W~/_^XMy/?Uy~T:xC-̈߾RV(h늾]v*UثWb]y??35>ݚmcߜ|+m[ugLiR)v Rkw-7gjZn` S {٪,\Ks&;E{Cg4N[LUe?%X! KV(ʯe?~ mjד߾_b`~tde?TXm?KP9`Eh'ktK*=g Y?棋 VZs}Q{^b]v*UتY?WoR[x7_F?,UMOմz,???1UѽV?sTdAT?6Q~Z??Z)bub?~k51WCQ[a%k?Zd~_ӒJkF7|IE _LOOy?^W~Z-7b=[oz^q9yڔZ9eTzkZ?Wb]v*UثWbOzm%mԋ~c.zq޻?Qg?n;Q>ܬIP҇d+]rz{L׈eCjѭ1+iͽgqye ZS_[ˬ?, o4iQkjsvlz&NN#?TT[]<?iEkoÊTvLQhu4ImmqƞB]U]Ɪ&O[9H]?[yjo־G8=NѦY{FH?FdqV!(0?qV[;&Ь ݍUn,@O| =aOrN*F;H?lUQ???wl?s??^}kiBMh?Hxtj?Wb]v*UثWb$CUiVM>Ig?NH~8u\5B8Oi0u~]mOZ?YX?O?ZaYfF`8J);ߘ@yIQ&iӴooЎuqM?ۊdko.yT??*i~kěU?{:Y,3Z6Z]B?y?N6*UثWb]v*O/]XzY?7][%~^?MI捤Im΅Q`z⮸ωCFpOݟPmӊ0wizYAuaωӤF875<~,UrHi' x#mWb /Gc_gs[_٤&? HE>Y:_O??\UߢWEr+O^FԟT}_G#ƌd4zb|]v*UثWb]uTF_ՠ DMfQ=<{j#|٪Ɠ0Peඨ֘@_Qjtz%CM6L^;|$PnaS$;^X?tSVE#j?9?%[8>vi[y8(ޯ?}^ثWb]v*?j???IJbA */o%MX^&bWnKqVM~~O]mt?\HQT# QYE:.*lUثT."qW??a=bJ]v*UثWbeO0~ad:sS?Ұ7H`a~}sG?EHlcY+ٛnqVE??ZtәXkeCXʷaH*fH wxq_[?'jxVFz??8?տ_*o&Mz4[!{ѹ~Zpn=|6S[wXo_5b?w}Պo|R\?fO>U^FUثWb]v*Uث:}^Ơ{H岵QgڬV&=\?05@s(BIK$?L'6\$o^{EFG6!?6gqY-^Vw|z?А?KzGj?{G_jJ> ult֕QpW!^JJѶ?:Kcא5C~~?eyu?ӛyK@~EYzv*UثWbUו˦y9HU$rnqWa??4G v5FA^x;?6[h}n?̞?BY/?b~aֿ.m vo쵕Q9(`hXחF|UZb:zO8s?z^? ~U>?9^?OnmQ*[sUփd 吮I1Wi?xlmt#I,e?ԕu R* C#~d}z8,onpJccQ?A{ nB?V].o/Yk?][Mo1 +P9sz!???NC;Co28 K > y}UK_̽A=ʀfƊ?LUZu^_Zht^1i%@3zt]OC튭#βڦPAzTh$eN*_9LINH𬍶*\U~p??Uy Whzi| h?ȬW*-qTZtNɱW~?N?I?*_iO?^s9 $j1}=I!y~?t]4jko2iiƼTx[Ԉ???:*?Wb]v*UثWb]v*UثWb]n'ZIqD,һTө RHUvߚ6z'|略s{&ZW~TAbZlmW?SYኛ{~;2o{Ri#hYx=9/q$WƄثWb??.Cǡ}eZY FdPLk(`ڻ|]b?QgJN&?cF"Fcu*vyʺ`ƾn,P#J-=A٘٭F*O?"_?[]bĢ"zIדuߩ늳UثVy[P2z'OTȥiM?^e/O??t?k;SG9G{VDPk?R=aѠo9?QH)U;B ?f7Z?g#??HDQI'OWb^+m[FK>SP84Tđr]e?hSs%Ρ}+|$#c7:(SY?2?^,D^D/@xUʩzWӮI@PJ^Qӟ?>>z*̴-BM^($?1ܳ1%MqT~*Uت_%?Ò)gfcEDUݙArEu \\ 1qiTtzW|cDߡ,x%?*UثWb]v*UثWb]v*?3?38ouf \KQR .Wۑ#ͯ.t b]KUV m0uc?UqW:?;4i NܰK{?.&~PgFam?aZPW W~&|v*UeԼ?gS?'Pd^yp_`cw柖a}[G#[Xv**{ UWmGM}^.fޝݢr`+~*q'j⫦N??osuy?$dQU? E?tXm`EQ8Wu^cCbPDe:Vo#D]|*Jּe>d{bHmkyٕA{ʺF?]yb BBnjAb}??W?V婕L܏a?Pv^)kc WX34_#DNS'zZ/J^6q|Ub]oͷ7hYbK%LV\{ ]δGt?˵-m@*A?oc=%qlXyT6*O-jLYOwq">el@]>GekAҪOQ=늽n8R*j?h)Rz]v*>^]?W:fԏ~˔Eܴ`u#c??X|M???TI.IVyyѥI:[x`J,0++ȕ?⮣5z40D?@UE_cjo)z\E % BȊ⫼|W?ZfC_z(P?iqmHbITPS^yz|YnTB-*Wi~T?u.RbXHE'E_B~gd8WbW?GS0qWV?|?ӞiH\uicw#mg_tմ9#lwG^~=F*ڵ`[?y )[lUbeBҾUثWb]v*UثWb]v*yq*?;aՀ;zϺ?aN-&?~? T?4Um|P?5&? Q ՞XJF#Ԏ~ҦN4;b^?nq߀A^Uz/I>,qTf*UثWb?-㹍C?eaPA WMt4\;t?^]Ģef?ܶF*>o墯bҴm&?Gb??;QxWbOad?DÔjQ?vaŸtJmoqӨ?U`i?CƇ'⩷歋\yvxX%ݘ[wXH? So+jwweCzTtr6{|U7]v*yPyI.?? 6aqr?V煥Vx?J `)\Uw?ʎ5yy owZ??pαX?Uzo[ [nLK?~Ԏ`LWb]v*UثWb]v*UĀ*zb???|_ɦxIV?HZFتWomawVv1:0FwR7bαyy]睝eu+y?|1U[ޔYxVE+KNU﮴˛e ~?Lou?h|AiUL6Ѭ`SNiݎLqWb]v*UثWbOf2GSN;bJ?!֞aզPK @+/9WbSqڊzhp J|k 1 oNbuӫE:֤ ^Zov*UثWbPimA)*Z 1U='@d1iڣP5@i UثWg~mK ??loԶGr`cXLUΏ*"?񛇠J}9k||k&ja?oIi??ڴummuI5R:qR>˺:(HN1Wb]v*UثWb]v*UثU;hch'P* o9\#-?ޚOӣsE״]>Z~8D1?7?ٱT}? Fچ"M&ZqD-??ܒO|U[v*UثWb]v*橬ѴVV?cw"S+ш^D( 1$*?? K^Z^z?b۬[nS㊰[?Qi{M?PeNGqPmj??[¼??u*B@JbeZ خk xs_SUثWb]v*UثWbcB:i ں\ڱ~y8f^quw~szZԖKan1??U?FZUW^k?~x|uTJP۫Bz*^ UUثWb]v*UثWb]v*UثV7o&E&&ePicu^cc^iiKon?AEU]v*UثWb]50i? u;r^k}Zu8|s{i5}JX?.fUYXm߱U濚޺nVIR>O?*(y*L#ijcԏ UON?{da#<u#`C?Y?UثWb]v*U'wkzP@?!TIb/61jT=zhjwm$p`IH qUEX|s]?oh$b X?HYgkMյ-=cH|ɖ՘leQ$qEz UثWb]v*UثWb]v*UثWb]v*UثWb]v*!ADcV;?PvQOݼqU?VQ꺼K\"sr{?s?{ǟ@WU,՘' ^]kgl|˵{?$mҬq* "8 KɞTIs(?h{(߹8?]v*UثWb]~cnwEUO*t?^_ë0[EB$]~ \pN'͊0yCT~Kti?M8OVT ޥɼsW~4b)Us*<&S]P*t-#`{YVr fi }6wjp~ ?…Wb]v*UثWb]v*UثWb]v*UثWb]v*UثWb?cEluk[?"7Fc*O?{||پ?Uz'g _o.?f٧QG oo,?{LI0B=HAJ?UثWb]v*Uث?<<|c^?L71ܷP?B8S!Tb]tXX?3lU蟓f;???hݖ#"Դ΀?I~][eY?UثWb]v*UثWb]v*UثWb]v*UثWb]v*UتTKI?D?cG>,#xo?VSv*UثWb]v*U$󗓴?ih~}Uu=Ny,0. ]KFpN?^CO?WsZǛ㸸[!H!fY?wv*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*UثWb]v*U endstream endobj 63 0 obj<>stream HWYosыqvl-,6` ?cc0NlU ^0?'̰ N[J?Gh?ґ?Rժ^F̣6޽o{Ս"1+m?Kp9͉q&iCH40C1t]=KL2[ +ʲ V`E?צlg U? a pi9.g\?-sJ;8=`Y`?^eȋ c I=*Q#?q?I?y,y ?Y4oif+,|eUZ>3ou\=e`9о ݣ㸵l5ccI=ӥOjQq`%\z8/{4v@-=I|kQ?${ݝnH6<)Ҹp|åeZU4JwvveØ`ؠKX̀]E7 = ͇vQ2~AF\|?׍GY}>mGUҕ2RZWL I?RUJ(zҗI+URNiҝtń<ɇŅP)$RrV? KI:cp9?l2|_wq?>J ?1 -EI\9]'@r^{Q½,^:Eƿ :k*p:R^FLx#v@KbE}A:}Q-lWu HKOBlkQ?"Eнed/.˷[V5 +`Uybr?z?I6dNl4Z?YdzlE4UJ??Y?بDYm d<DZxQ!Ak-rZ!I? ?QWjQoV*uZ==QTV8A ̰VdKj|zJiT??&xAfU?? w9>_Tq^~_?lo޼@h2 jm3?i}h4 DիW@۷`AM >b~8[OOO?g h#鴇cd??t>! xz~;wwoi  o؇as}_}??or >B?h?D*6͛`gO?e$k2Y/xF}>sOÝπ?Yv۩xM/.?i[3ܥtAeVl3*\GD]VrE*e`RQ?efo?pfEn}yG)v cC~?fCkc؋oׅli#?v`\Ex-h? & A &;sЃyiHuUVƃh ϧ\ōɃPk{oޖpk?Ҵ??Fp$j& =g\;F3'-mLKL?d5 vQFIS>糶R^LۏxyruotًYMzw=;YGy/o?4|ixnmC9??<˨Kiu!.+&d' Y)J4Vh m)Vz/ m?-Io?l^3tM+? K0[5p|wRn'Ĺ #T ]U? JJc:9_!pJ!2Pa'ʾ^?;T$Q~QY6?7`QaO"BDug?%[iXFev}`{>_#Sp?U\YHKm?î̫L׬.㺐uWǭa\aW@A.Z#]TPȺ-ͫe\mj?P)E?9RޕA43[|м>R? q#喽c{RPsi|w?Ѭ9Ӳ'ʭYI|ޜ~ X2He4?̀O`x:d ?IId2@?SpӊҴIi'2|=2 $ 2 GhD?i tx2R<#xHgW<%bܹsڝʦ_h"{+n +{c}z% %?y?5\ ww"j\DǙ[?nKJH@8P1p?Z|?_UGxWLS5:JErQQGCZ̚4&ͽ^UNʣK6NS-j.׶ThthiRD?P M4p^Rv_Qu1jvTZa_\Zbܳjy!e$/7)jrI?w +%aUلi?]f5cLr ؐX?f]xocLn^_Bk*>TZ 0 *SKqaWf^8? +ª4ʀJx ݼVZGCpyvn}s/LS+ Yr.\$tMH%R8so5SXIf@h@:端?3@8(e/ھ_'F;xg5U??:uW2]v?ǕStnoRqW夻rӫN;sOgrd4Ep5PX~?jYLCqzCOٖ쎆Ϋ%]z?z[]m5jjz[{wodߪ<՘{-ǝ@O*NԞِuǓ٘ Zץw4dt5^󽖼{w?{ .N?LO? ,υVj(hd]Q! !MQ$RTUI ?.:Q?ns3kU IImKɽ 覿M V P"xbU?dE Q?!!FAwvbi t?/|JdYL j ֙ͨȦi:S,`p0oŅOP-Daڐ?tKoel?ԬYctZ3谽ildOɦA7u%z)R Wg'F?nlʾRrމőtd .TfUgWdV_p}??/qgeVd ϹOח\Yk 3g/4MnMOEۍ7{F]zԽ2?< a?Q0&?kSX&V!W?tw`[cAp)D1d&?K`fl|QVa`erŌ8h M+Aqg lSݠZ7? ,`΋dZ|dNnbPG:?cXd`?gmY?|^( >`XSlHMGk>L;;;{rZX.]Ҋ^Jq?ݫ??-1~4lY8u?. @obot 68ȼz5f#Ij{z u?9| 8Mh;G?ݽj-S\~;fM}iˑR[.IQݥ΂sW*3kSjOT;R*Od/8)w {J3?e?7Tvz{GgNyVC+K+@o_^.ku vw_/sӓmkjh[?P|]7}1<Y[QJ$?֣*?1D7R8D?M??DE"J?M#*L??ShƵC$CMmZ?AiA6c PJAV AD_qQSM$@ oMQdA Q!"U#a5KY"1*Ͷiau]*!GmOSuiNeSW “ 9YLZϴ?Sl@vLPu?d$73Ҥm&oQxtj. j`U{?} ㏇ gO>y009:?=[ Uեoiy~b;5 csSc SϖfKbpU 6Dt 3 E4Kg1fL??Bdv Ԅuap0`c٪ pfh\̌LSUTmn]nlS3Loǥ aC#вJVgh8Ee K Y%Fes*Q*C'B\7 J\xzLA/AxaлW?޼yvNs{{ѣJXh``۷{rS??;AnL Þؕ??q~D-AC~>J */餙ロNd@_~??vW?sh 뒙BdP۷h_N׵‘[;׺ڬK))k/U9Nf,??V\ZHu妕d/DMm,}SUns¦e]mWz;Zz^L[}~?&WT!H%(H?rr?T4)BZ?oaj̤o~J m?UaCpy9R Vr$Hph"Q%&K kQI[?iLY?І9- ?B%:4CW)Kn@Mi0;o?dnb?Ȣ;cbMÂEWoC?@K[jjiA0c?@h4S;sø#!bK]?r3f wNoysޯs:{ {6K$Rp,m?ܔpZ6t.c2ǽh{`ZaV8c߂˛r o 6Y?uФSUKXԪKyPW"PIM|}fNKVкUKJ?Aɬ AnKlT9~tڑKQ`UlnzUd8Wy?? ?kraijv5??x6R\z]c~\?cJ Ka35H i4kzbt[+ݧ~NdW׊P?P8^ ئ[?NQt^0J3h|ˋ-։dR?A5ZFȮ)?4(D?ک z0^~^Y6+itV^kn+V nK{4. ~ddKXE?_m/У? ]?7.@^~kSS׮TF&'w^2 W/۶mVhmo=sg'chc[?駇~þ׏}Vn|=nr=;ouGFNuCU༽?B`Ba2кψ$ƵbT:Q?M<5T86w"pnmf+A%~s;Z[$Q\dnD pٻ~w}T a۰aŋ/_\~w꣏>"xҥ?̥?s?Z_њU {?_?F 7[M"mqD??/_?sd[}aЫ ߜyɧûzxףl{Ccm?y?7=-׎mn|˺׍oݰoǦu_>̳O?uKgϾ֙>t:?4st?\'(ՅFsq `su??w^!`?^}d,}x^4i.,0?Q+fVTh^`E+ VgbU3̆&s3÷ހ:c?νƁ ps)?rBڛi> Zg ^ nY`B#[1N ?6wE ?}FfMܚAux w .e?F[y>*p.[b*ytǷsۅk fQ?mb*e+RTѲBeQ XZf?m?ʳ{<5y䡰3eb??U@P/C??g ? [6yhZMKk-?/]XY#bXW)"TP2:f$^<bdY[Nj o>2\!B\s=Er*Zi?O~ᇣMksRJ^.l/4·er?sժUWC1 ?h/9`9ڹs֬YB-᫯?r>zH#;??CjZ ޳Z/o?K/s}ṓ|oљc:u:ss3\27gzs{݄Y&+Sl`LPMV .Itո ?)B??#`? CR !?֖`)]XTl_e?tŢ&,Y`?Đt?q}?7 ܂a4V1 eIe?@)TfAhQef5*.ck?5|-!`?Q.HqU]WfrY#V7"L0eOkPjz[GSLN;PD)S^0}ApYsuVq9|rK털XL\%?XcT=I |aU'yPvdju;T%S?ALw"aSB@::L_qrub-?OJAlĩT?iYup@ i] ??qU\t:[y& *7`?kq;? ~-ZE?Gn#! rF"Jf]ANl/R(3? r$ZOay?l? b{ ??iS*__Ɉސj}Sٳgg?=.;pt?O!Ih.\Ng28d\Edɒuie5RJ \fgַƸ[on?b7B~G/^|{ddݼyf&1YkT=?Br3f!p Ag?cv}x楻޺U;7-j /}lhڕw?zջ?C 7 -imVtoG|O|AkSr@ke:mngNd6^ᅲ"Z R23eomm?F =0.ƝJbQ ?;hkhVnlj#bGVЉP7JкR 6& ^h̘V(v`ѻWК֠Ƨ|;U}Vʓ eS??4?);Ӏ??l SLdᄗ{kźwS?3h? E=d$AIa fz Bk;кe'06dk?LUC? bLw?v&Rd% kOAށƺ\Fhʃ-Q?3XnDk#/Fb4JhӘfA!L'[*ɴZAo{l NpB؈_P` zѵ ?9UV3IMGƆ"z5v9Zf?iY5wm(䀙iLm5G&ΜEb?g~:?E_q&?ݙLU_?Ei4@儝YlsMpIPdvݙ?;YZ/`9sܠu3Z|n{fKٹ  ?3??К"ߍ@ ZG?xW_zb϶e?.~n=ۖr߳3g7Xjo߾m?ŧV> C^qoZ}U ?ȁFF:ơ<56*GuruKwynU?r_hi!qF{U \ -E".? 0X0?S@רܗ:U\]wea-,EB8BUM̊ae]? q?Kޕa]Y=7zS={`*PB]At~DXW5J Y TKkk?vҀ\/DDqi?eb{MgN?n^Gf[?, N?̤l2GAZ_<øJz޼[ǟofЗP!??gF?<8ntMy?Po"ǎ=yMuߠϝ;coyޗwo|sxc偍ݵ۷=u=.ܲ曛V/ڼz׭мmwkу^;{;xXg|?6vXx{mV+oʬE;/)ȖJJ[v;:QtlѪmt)<.2Stu޶Y EXIRݖ-ڦDpMti=DU7Yr>U%Yir?Wڂ_/1vuYv #+? "YRuELRtƙtkF^?e {VQHSyYm?*dZN-#j)J? sKx#}堏?`{/A -?13I̽,!;Zs @ll_MFD??RwvQ?}$?y~G?>WVne\tSmy/UVd CЌ+G?J| ???v瓇q1X%C VJc|m0ZZ[skӁܑY k*X??StO?tjj?۷o?vgnyw v_ض.OǙuI|=?}?hENYƯt? r):ѣGwlfi%r?h۝m?''zSmgrCu?ZNL!zYr>ze"|.,lC?FvⴜCS|/E^fod |{}ؖ>|mkWןݻk&w]˟}tL_yYwɝ7_tǍw뿿3O-|_{69gGF}Oۿ[=o?6vgO}b…>prT:WgLZl?Z͆" mNVT"4k0'Lm l7FТi#MR?D #m0X= Q` {: :6$R76o??t'3mєY.umb?hfsf%Y?:a`z9?rSL 4j?!?-޳\GeLğmܰᮻ~aGG6>6ss=ϳumZj5|?Tͨ aPrG'rs<۞xDѽܳ}۶iL&BÃg>D?Hl8eԗ?$ EX |]y R) r"YFqʞq?)S\ܲqQעVN?ӓNC{?b~6_'?vw?\m = P {ް#8&%da~[w^e&8D?q#d`ihJ߫~?}ot^綍M{bt??xmypu#O߳WuثGNƉO?ߛf/??ո fSZզFcЯZoLnLzX ,vC0C/O3/Ֆ?][zйҹ֥X,^r'G@onКӂ[{3(|x n=?b%XXiE LhŊHZ;H E?q8󈽀jATLE?b6_U? I=h A.Yhd?4/_fu],Jj0(@KJWOޑ\=?vN s uu3Rvj?WukKk5? zh.SuGFF8.pJyKhyIV?/Zʐ́??jEEɉ"xlaCd#I?~uwO잸gƻ۹-ߺL[۶?r{^zG^;v؉׏ ~\u Z7:ͦFHhS]}klv2jN ^{ keuᲠ҉v։r ?kR'.-lTnk{K΁Eku{>y]z%D ,جtBT,KMa\h ?|??DlS_έ*$R+ڋ߬?_Y?kAST = hWjdT=PvM7}A ]$AP݂@tٕ+Wٹu_<"nHp5?9? Bχ?D7?>0%,#@` =B|,Q/ުo[}Ti+rWRPD̲te״f}SЫۇu5ILϕeH?!J+򝼾5Vr9~3?cKZ5d[?LEz%K_?DH?0}nPuaڭ}Yu!mӖn7?Iho\L9uu dxUlB9n?]?x_>R-?(˴^,KAu??[]8j}Ö ˴OEEE?(zd Fԝ_@n.!8t5fWE~{?~/zi?wle ufuM;ml4?xwfNy?};{zv{w>t|`=Gn]eMoߺa=Ç~}+O{g[ϝ}g6iڍB͹fcѸ̒,aF-N\ _΍&?7BqgPĤ$*??ˡxMq2<v*?|&BoI/]mLtoؓ\O׌Vq5ƅ`e?E]u?| `_XvN??1?݇{6|nmvwܒѺyw8߾qsW.|?nGou?JREh?Y1tFp:k x aX*r1|3"d0p d?ux"@L(c 3'|fv!O M$kQqc TЎae@JA{;q\C?L@S^@-\H?*Н?+*p&EUQ s]U25YT\|9?yVUYI? vC s3 ZOOG̋- ,\m0j6?N( ?'6Cd$  `bqŊ?ߴ3?*p$TIA[SP؈52C?U姆Np8Tr.Ef֪Vu iu ˭V?? ?s]KTౌz Y&I ?uNER4eTmp8B*P?p?D f$I?1wm^0Rtc?Z+?u?ey?CB&{F0?=??nD?z"_]7z6?[? cs Ys]7?סG#ooQww}<3 ZnDn`##}Fi__}%}{URe~;~juGzچvyaGmk۵oKޮ}[{:[v5liֻ}O|ܙ];_t֭´W,OzӥԔ?]-fU(HRB BY?pN?gZZpLs&|h9~Y # K?_  VU)HRB[0+UӺ*kZ?]?\?UwS'G^J@f ԝ c#v 7?`={?Yܼ81hHWQAp+ۛWK88xhqO*?@muP]j}?zR"5?70??%8͈F`Qm)HYQ2@b???M*lH΃(;LY:ZTCX,,^*FD^X԰eUh]s*oōۤ+ zS"'k 3;]K@b?N{MjM?Ĕ1qj Bc`Pu#(PwLҞp|jRE0n_S2R(a(]ZRȍMǩfxB-hH_Z?k.k8?[GG]dpSljjBϡEZ??lAjD&&^«P1"O=0nDΞ#̙n\h2GB#EZ/h_;8D +WVt\?qF|?>sbO׿s?{ kZz67޼Wͽ[[{|k8ws?_ztlr|ޜݻAfR)ðf ^x)aX!D)1iS^??BB,Q[@y@ ryDZvL2 &IǮ۪x4&VAH=-m"qzlHEPI\XƧV(E#u?2Ub6?|R0OKf? '>lpO)nՎۖeգìgb`l1Y̫IcKG\gE]K?]zuyL?Ÿ J=q+o|tM?◝A𑒩2s=BaUkZPV"'c??7XŠQZHa)Xtk$?6YZ0|y*?g`#3XKV\A;; F`joh!|kN?H,$L ?!Ee^~:? Y?U &6$@ `BIHpA@*y(?4Ik}9E)? ?XvEC?*uQ(TGGWsa1-sit\T ?1#[9P9Dfqu~jS.R~sob~ld}H4l*MsK LIBc /YatN&y ę{]?űJ°} ^i9<?.k)~??HbV8'rLv!jMzḤg/^esǕ4??yB?||^|A֖L\q]?t8*zpⱟj!K?U _j_D!?hSbliHOJ ZȰ '6qr:MW_i$ybY&w5{uqQ\OϦH:eFn?$#\f'׸,7?*dJhĄx~?,?J|D^?Y *|:6QzhR0u \Rس9mn ??*"C7}^翷P/߿\z[Z掣hQ*Z8ѹ@{[o\51OVlj+\Q)4u:г^udv=ʞ}}+{?ʾGzZٵ-~bזݝvo_o籣G~?>9; Ώ]?^?U&'?j??XtF+?VkTqQ5?y4?t-u5s?Wy EiH[T3>?T{q]PMF] [?$:d&hwBT 1оW?d?[`mzխ F?Bhjt] ?]pZO[7mLqyw|Fh83 )iԱ̇}p~:uw@[[?i&:1k-ZtWC3Ec.=qi,CCfsȫ˖~ad*?/*KAD—?ݻ L .޷HOjVQt=srUU[p)l?Co$ fyb@MCdm=?3?]] G |uSǎmjfh=o ˋ? "Wa^9 qo$~^zg?۲bjݷwָmcu{?n\޲~Iśk*Z4~i˯^hZWݾyoıs{{/]tmPndύ9|$cs#dR1XBZëV2b\1O /L ?ɀt, ?Y?+?j ?:S4 r ru"d?RJHp aN8wŋS?*6*ZS?+G<12qQ!vIl`0фڔ\]oԄwx&7?nX!rÕ?}4J?bl~x̟R@eW_[ZëX~Fhxo :5+*Nu͚Xr.1% jKJyJdqlȒ;sD㘪R8:%Ӫtƙ~D'pNbH[ (?خTQ:pq"dA?)cѝLQF@Y6pD[8%i yD;Dq8^rEPa0%] FByBpH~[ ipgh_uCV ,jW?M[<-1hrI?}JG8 5mmX;d5(嚉e~_1o\˫|eӛ@k T&! Eax* o,7tsx?Zg=o?.\{ݭknݱ;w>gӾlް湖ڟ>TW5?O5[a7>|ıݟ~˗{n\>p#FFIsp?#pq ]?O1FUPDp8A?$$45KtogDAAZVc ?BY(???ehw?z c|,Q,hQKZDqa>sr\Eڀt𶎊RJdT»J)hwǎXuR(f?4pVؒuĠKFޞ3Y BuGtwgOϞG?b-ZTYY\A)Ο??{boOKHYԼؕ? F5L- B,?1? %ɸ賤 |NN??Q{(4`o /xH4?Lp?PaWl&JA8:!P7u.}k8V),3  LP0~X ɰF468N[EFP,?Xp5NF(|Z2Zr,?XCL*_t)zSFٳg?~߷?ϬOSHkqrr<+ʾBKCev{'MYK\Q.Dܖ[?{޽{?Ӕ̡sӄnQG߽[вjji?iڵf͚u?ZceE?˷au_?sWWÇQ39ywՠes|ӛTi߃9S??_/bȸ q 7;l_K?ڴbOK]_h|} n{u{k͖ז-m_\ӦڊgV/ѪZꗼѰmΎ=xkw͑C~ugOx?:2,K?B.C?k!")$?K+*"r?? Eh4X񀔫x,D ͊d NF?ƐN  χá H/l#D Hp 2}?HQ?2(ʲU!#7f] mҲEOJ<K&?دب3,"uE(*cKm5. l)?XihJl@Elxf{ι;3]T%RPe??\Q?Rqk jtw<C?JyC$?6c{nb}!PyeGXrHP b H?xTۢE֕b,TFS?B Ȅ!Ƒx?I?98ؼ燇is P_V);PّbϱP|$d,>PV8 L | Aqn2?2?RәD0*M!~Ȗ?eb V?EmqHܖ?@9?qO]±%8f<{RXϺgMܚ?vrh8P{8G{ }թDy{Kme~^L?l^?uTm;ݟkkڳkWcdC_jo<|ű>{39l[re9eۖ?̱]y-tqDajfP8Nȁj)<@u$H,y?hP_!44sD/ jQ^L?X})H,$?;nq,r'ª ΰ< YR¥l?*4.yzp?EqE }z??U[;v@fMaaj*??XSoXskJkxk˗/N?柌b۷o `p+?׮\@mHt)j]t$?=-=lG?Mak?zL(4???|?В؏B-?׉ ^4?((K#pח?HD@k[VRJC[nf%^EKj<|Z=J\Wt4/wqo/ML{!zqNmfW_}?Y?Z?`9Z U<גn?Ş{ٻ7Μ>?S|xo@xS^O%7Vʮڟ[~eZqm[궦ʝot5[ٲ"YvU{J5EN}y?fߛYiY!)/HB\"BpQ*a??6e9,wY֥HyU?` ]?$c?:$3J?:'??0O*ƳHPT]kJ)OKtH1׍3v??`]`l (?+:;K ڇl ᡋ=?\`eE^<4.&dQAz:?z?ǃN|[f>{v0[\*'PE?{?z%X0oDMg?2?t)? >x+ҘOe j[XlXJ Z?B j\0@N4%?;pvcw"-hcGNMpx?^[CA`" #Q VR?$E󅷱 NO#fQ?D4/9M !%h?Gta $5ȃ?}Px:d;Z]??իWg33efi}u?7o޼ *''' {9er? ZrвP( ?MKlYz=-KTJq [bhy{c>Vy,c5K|xsv=|_[ȾUO7:?۵y²M?ȼ[Vvw'?xgZyV.0h?aX k?KŹ5̂taD2Qi|cNQPM?tc s*TMY??qH2hqKNYzhn56ncVCMtR&B=fJRw*LЃP?SEFxmuÈ,i!7p>V PT-Z$/X h ȡ\Yqxc^2t̵ДϗE4cΝnQ'?:rqڵO67{'Dk g>?,) ?Kpe?b?[u#"dd5AcO)h蘠DLv N[ TӅYV&Ba']F??SHa@? =.JҩU!N?C5z68Zq16?LpP\:?K[<9Ha@MGԲh3͘tlq =g g2?LIf]V^ittq`p?Ӻ/|re8رcKOO$?kʮMojCtYf?H˦Mg??Ь}Z{օ‚Od=SfFWkzz6?&|]oce+W~q[M&mtLNʠj5'BUZԬS+:լl)?eRx?u}{Y߿gޝ_\LZ}w?Ά\7.|U|Ů{[r]ۖvlu koMy?ܺ!JB?R.W˥`*eT T(\h2LXM`]D ?X?>d^2IHH1g`tbXE?hQYE= KdjKb4i e-,&zJuh(+> `@PFJ 6"YfSPYd?>h /r7@߾{m޻`?2lj̧|ůܑ~V*^$BT?CϟĉBL5ld⛯y0-m?~RTG-rDꑁ$=SE?^ؘij?24? вMI^V#򄈄Y?@&v]PYJ]?Zdr?P-kJZ UUrjJAdzE d5.(+aFxx]3$`Y?F _%AD ǃq?ro 5.?0Se8x4 ??j(H#XQB@4g8ԭDM?i=?]Ώpfi ??n !??JSB2{9S-orh_ۏqhR?HV?UW\YRNLM1](i{sww /? o7=@Kboy?v i}9MZYtf=א(N7|uQ_n_xpG#Qtx8pu?~F?G-qٲo/n]VڠNHalY5?z^5jN#nD][@+Z%A? ꃦbKN+fR"Fȡ[Zh?be/xfc#S^?F͂AX^xĞɽg~yC>p}|ؖ-;:{֒1;79gb|㻎|cBNRhAf_;oľ{9LPsӧIp `%Wh$Y`@[mp+KmĊqq?/H= m H],q?OQ"f?Uғ-ھy!Qrae?YttlRXL6rxcf?Y2'LV\Ru34gǸ\g?Bnafi{?3vxD|U^?U=QDS3TA ?]an?տUj^+Z/pB?V||||EU8n]}ͥKrO~6? K_|??K'H_Gܾ\AgM#|r~EȑoXu-Snqu3?ʌY?ri;UPg Rie6Fk?glv7~s?;-kl]1mO/زgw ݽnϟ|b퓫nyŏ\[w -jmC+vh'ɑEn kDlxY6]cKò,SUIzN-Ǟfrj["E@YJ\C{?]`?iEA'%)U}E\?w6wTil{K/??qߘIQtԺ39hэO"BBk5λc\?>@[g wž:?VDWAEHc )MjO~k^~nw߰G{x;Zcpֵߴz5]O?amvh̛3m5fh6ql#*mISQP QK5)t^u?'A!ʠ{Au,-w?vRA4UH?u Q^p]gJsம҈ uP?˃}/Gڐ`fR-Q?j< Fe"`?f)KQ?TVi@i F5cM? P0 (fn?̔DBZJ貮fk 8{Yd؃nec8+DOo?ަJ{x??0۲*֣?nhJ?)"??SIخz%l TU&"\P1+ۓٰ͕v?@ZvŌʾdP쁋Y6/@ςyH?b2R?Ʌzh,?4s Aw%įxnAfQ|@@H[4VBb`?D?bIR[;j'm?ǽ}νfȢ(Y??߹eZfhr;d>?2 Kh "y9L|6vTn?77_?eiMU~"+jEٖ[,?-ܶ ?ۖԷ-t:m?zo.s၉~ΥɫoIMMZ[֔??zi驜oٿMMkqLӆ gjVWO޿D`ň٤uQ8hjDVCeT @NG8I #q]j4&b3dZG3ϻz~s?:>s~x/wܿ{滷|kOg_}ܟ?…^nMS`@1XPJ.Svp ΕZeQCY&r| Zr?F}?b`4AĄhċp2}A,VZ?\?yOsdC/W6Mxi]@eޏk?<̯Z!~D(EףY`֊V"?2]t/IAxd:]X]C}F=MiH?uz`A,֊?Z|i#I?i !iec?uъvx1mmr d녯`U3оK?(+X-*?ʷb=?GcȊv2ɛ/v2L$6&2ǾG'L I?dIsX:2a'hIum\J]j3 =A?Hu vo-_ܟ<5W\?߮#A ?I%IK۷?v6-ܶ ?ۖԷ-Oնlc?ҴynJI>l??Fo=?E?!9y-[>A?N][C{\̇\2Sض?"?K_p JJU(+XUXEmW` ?t3Lī`{4Xłӧ~wGq[{#}O?ӯo:߿?? (KW??j`xZֈ iQV`xd L?Y2ᜂtFh9"w?А^`t#ddqTC8ą䕼YY}v hYP$,̳ZR/ȫ2?|"54vf؇Y s?ZJk9ȇM?ivfj"O?t?a?yT/X N @`ƞua?d J:B:t)?9d-mhY4֙{WZyiERמH%qX?9?xrN WaƏۥ>atd}?]ti1%kO`YI?}Hzc w?eR .J:Úd,rC`"hm?ZEt?]DIhƲ#^`nE7xY]] ?yt:?gl߾jfgg?JuF$hrigֳ??_m?h?-=*zna}m scÇA?DhmX\Me[3'7jy=eaTWBҩ~ErEeU4v'WM)DP^h uQГN @E ~4^9sWOv Oy딝{ o .^{+NYv/?JRRDm5fˡ'ۨa00. *%Y(? M1M÷CQ&^WioL??f(*%P?DYC`/+3\(=wDzbo.B[M. Nv A?Z>MQp.;C~ q$/pNī2:'?z?Sfv evsEa?W O"v?c4Û@?rLWR?a8"O fAfh\`T"RqD䠒z]G'?h"B+?9}^3?f?T2Ɏ?` 6HGLm!׶^?0 (8Z;_;? @qxg?ܒڠdqRoJ r׹M٤'WVVV;vӇm۶]|E>z?AlٲkpI붴KAiY  ? ֑ooD9w֭[7iݔ֨ǾzUtSs3M f޳g~?hk03?m^}yyqǗO{ pwB͑#wnzc?wq?؞UEPʩҔ]Be7ZDcK+ʨ>}-A plv?kӯJXu_+?qb`hp$Hpt?@Q)$?[&Yvg_zkX6A3Ap?jg4?UVT׫w>?t J]ݮpx}Rx~C=g l?Dtp20? hi?ͫ$cUJ.5j~aQTÏrUG7@?aݸef ?=Դ??Z/Eg[Qt~M~%#d?kk2Bt&Ȧ?JƄ!"ֿq?aDzcts'lII$qX=#?>k D?g!vhVm;h`mfme\Y r?T?aPj@nY` JmPلn uWt??Gp?]H3x??ٴ? Eҽa9.?cMd4Vi-p?9TY!ZPxZId[X aaC?KEqU ?k?>j0?Wݫ">u+x? wyj*_}_?<޽{~kZZwy <8MȇKK-?EKkIInC–^!?tpZo?0;?bj}?2PzO@ ?wKSo~nh}Zvz?:p?ia?荩j?(7tJ@8\5F3N[b:LS2M+sz'b0cȨ);#UFc jb ^c쎅n,`>AAPj?KGE  !Jo? n'k???X>a"UtoN5?E aU{>?ca=iC`~?G?CVƓ&^YZe1G4?B?xVhSK=k-hYaE??mV?i}:e ?|ʶo=Ac^l5Oyr~z\qgS [^cR -[8 @$EPw€@ 2?~-UׄL6/M_fY3+IÚbu֘Ju𢤥yUpnY_LX$ d#@uUbUBhc+?d- ˜?k `a?]*Bl?,6&M l?&!MH?{Ka'+??6b [?#?.?g~f? BB??l&?B>x/ mL ޷㶝0immnm?|z(U6͎|RLilzHVC?՝ŔÀz*~׎T.׷oS;F{sww֯sh?vzw?^t|E? Ç?O|ʘzo ?{FqpDCqQa8n?^™Xŀ%njږ^8~[Ҷƕ |[^vA/oU SE?H2IN:=jAM? _u 3cV9&vOϸ)ɶJO"p5K  - O#P}~VB.%㱁Zc?ڍ}IҲ[&6IgdaWM?T?r;׺F:,MuW֦WyH?+?.?-,i*2vQUZrdqn(*@bIrf/d?|¼X b3 0k J5 _¨W5k b 㚓L.`l?[kHm pnYAKv%?35cKd؍F?t̑LRP?~\k^,GlK?Id?$~yՖCS ??RJpeZW}>c) Lž~St A?zMz]{;wvv>|HË n+.-=zIn瞴=sy˥с޿}޾gOT ?Cn棣_?}~o|x~;췴wWϳޣeZ ϳgW?f?Bd ]GZqD/Mw!Ƒ?&9pd`? 0)zh @wuC՛"1 `69lJJ\4?\ XPl)'| W)?ZAwX%A?0v#%_qyB?ʔiAa M /bKiG2I|2k:L~`z~Q}Fkp^vF2Dkz.R4 ah y|[lTJs?ST L׬gϛ)PVJ8:B?j!v?85lq&XJ1qOVe[3EAQ!ĦJ?x]{=˪P۞L@T;NYcVmhV% db?$] iPĵ:heY1hH?`?b! LOeG^[ZUXRqasr?dhd xvoTjJE?m舭~_RNVꩥ?<ꀕu_?>?E?>>~ݻDZ΃DZ3٧Or zѬz.h췿nG'sOp;}裏K?www::\pK?88?\ZoA}?Gw_?yw?aoۿtE?O|gg?_~sZxW{}MiDPYv|o EJ?b`a3?ꤑ:o>I A?- ѯ67Eu j4u&DKw?JpQo'Ѹp?o̜Q_9<7ʜՄZZբD3;ga ohGAdc1na |?UD*KFx~Q?/I?@~?@Z*-A-_j  Q?\!IĒd yN%W?jy??ikoijEPT^ n HSрj idORKLY'3J[?WedY֊#T ^(~)TR՟Rv,v?[*$mnڷ?o $;??V$V6PsԓY,Ek~-*?BZT?H8XBelL {f?^ia!m3KObPy\;ֶA?tELҔ̆8~?xe||U)ᛀyw|+a߰К^\\p{~~f_z:8ުx *tjKX 6BART&?rB.$B !S}ޙ.bD *?wH&r3?; Lpz^SK< /=z4.h=EIYQx8.qB?2~쳩 g3?iR-'ϑ2%oZk1Vy[__ѫyiq•+WܹS?o߾~d[np.]9^?Ŀ׋^w![2mZNK8BZ'k?}3\ gEAћ?L?~0E>?!2} ECw"t~0rk'DZEN$BL~RK~uxv k\??zQ ni̲?o ۺvTc @魑mZMvt/FfۡwiZmtp}j%?c?ȉɴ i?IL̮Ͱ*E?O?FBXFC9`VNS#T FzTTmr'z5?Ud`dCkޭsBh]4Ƶ`!'9?~?I?3LT8Of[y>ZңzM3 4=^ӻy-)hyZϫCk`z?_ܻ~gsm?rKޟ9'?GѴ?|[[?<^O]%n鲈ͦy'cYI5bc?93zŎxB iTT[ ib u CTt*"? -eޙ~ݠb ?n )T$3ep?s^sVoڒ8c?K(BSHcdpy@nq*?Ƣjl=NѶq ǏْnMyܘ-lNE YLG|}?׳g??ɴUp/ Dh'4e(ٷ"jىjru >#?؛鄮jQ})?= HB&3fbM]raڬGMѳ?:d!Qihe 0 'uv}?yN :*D64݊d??˲2Jt?qx@t~9? z)mH4 ]yd ?Cޒ]ƨE?dOv?A?euw?M?ٍ_K?5ġ)G{B4b1eDDXbgBM.DhPS@ (zkCˬmPX3m(F_=.Tܨ?E7?B&AF  pNcqC?)˳<[ES D??aXgv?}Y?dJOV-cV?#:gv˼?)?tڰmK%8Q 1l!mF( k~?~CO?9?EVo~>|էs~:2ٌ{ 珯2?}Iŷzks3z+WZᆥ]?|{ҹY .\9u+3_|Q?O7-wr\7u?B¯e{}7~ٴ0?϶n?Of??(~U˰?tz`)}_UK}???-&;L 껥NKZa4,??p/h`dBkA?HRtm^KpO@fZh&"?Mu+?H影|[lcZrL?m?zgfC8_@5+?HIbP$$2C d"Dp?X lBJR!yBX_iW@nlsq2?%f eg F e`]ф0?ѫ3W &nArvSVV_e?k=j˶HqljdѾsV!N^X?:*Ms\(d`!|%}11.OY{35O e"_*Sȫ? ?{G?*dG&W?Į1fF-u?Ex̖L$AOnȪxr .cKΏ<~s=p)>H?8MQ?m? ^_xʓ5FCR?WD +?FtmI_z.B?Ku챕v'+VrD3k>WF#k ,|'?C&`l?'*t ??&̶4މ:?=bIdhgLJF Ď۹W8}{W5z9u)x{A9NҡfÂ} _xl$bqڵgyŋqg} GGGOi}VO[)́|?w[??=o޼y>?OQ??U6w _ľyx `e{0x˵k?޻[@=|w_\ozg[b/u;GyzA:XK;tjbQ׃`" ]Z?hiFjbxzx!Ҡ>:~MaҘSz#ZS ȑgJ̡#ֵ?6YϨNfCHp vbXY&grTC_2H1Ǚ z]hGfA]o6}Xjm5l??AbS;#acZVz"h^?9xvZK?P-نU?^`0Zc7p? ؜]wsp1XE?Fo6X8kQIZdu+?AhM]ĊG2u)??Lئv'???ZHzBX?:uk ?J攁L$* cd ??gδꆍkӮWM g?D|?Zġ(YdcH0h?)=?_>9?E?sh}=T?dVO֛2v+saثWrOvyt;;;GyrNLK}mk??W/7[˿د{׺?I!f  *V[vkL`,,Җ{ϙ?@R? .T$?Pv?Ν;g9sσ?f>><-l[59Wi?ǟEpx(WO}a]L$mM}VnZƎvz ?wϊ^=Aݪ"Tୁ .H!|w{Pc78:wXVfu=:x|t8j]ENp N??ʱ#%۪h?pRErVzJqPy<7suC6cvaҳ̮D[d>?c*+«-?R]TRb\gMu xJ 2y֗vl+V ]XUǀ7x֡wWb4lI?S{ćA`a/z[WٹmxT򅽽J(hj!?p 9?8]R Py:u;k0N)u:մA4$jto\F,jI=VJh'Y$" md6Gp8Kn b[m Jaϰ?Bqmi8?vֽ2[oy)qc?w?_?kևFMNlOD㝞@Ov派V 7L=S-F =[vpA?@M|di_''af>B-o_Gmo|CZji{ rGϰv\¿.hFO>˗_13Bs~_~s|ukYG ޶k׮pFN =SWիw?Q.]tAVYc|@۷6W7pE˷n}gOkal~m #ܾ}?rW.h}?FZr]>*Ynϩ}U( ZP0@D4bL6`ՕǮZ J,Ab/`???QY0V\g,҅?H8<^,-IdIc IX K102UKV A`cߥQs r?cnpN7ESA:PsOV=K'?L#)ƞr\?͐aWBfg [ïv??څl̋D`~?bii}R :AZT*t{5P _~˻w,Fa/\pFV?n~'?!go"vKm6c&a}PǼ -h}ݸe(:n4hvӰ ??bn&|7OIa}rk]UO&oVqX3{|[#LH |:]ޭzAAB}?Nԑ* ?B,@ \Qxdl?R\ ?Qnd'?O]p|fyƓK!:%PGs!7a?Rl]1$Ke ? Ȋ?cW6]x?f>IG?O[Pԉ`VB(e/B}?C ag떅hwu?ZגG=L?LjUN>N. u~Pd ?u Sz?z~JTʃHaJgC@nq0z[ o_ھɺ2X>Ƀd\Lu<?tٳ{]r0|UU?]u?~Zc;AZomm&b?*="nki-iIn7-oZ6-7}?]K?*͛/^ [jZr6N֯Q^*=c~~>??ܽSim?_`~<_|~hD?,?`LP"K?M*OZ?VUz ULB^BASFҐ|q|J`,f1X8?iWnD椳- gz|JThp?7~XaIr?3Β+?_9 v`TIX&qK| z ʰBglvVkM ;9- \W9 OńS8gbWV@v5iZХgkaxw`i,C9O6c`a)~6veI0Is9cZb]Qs5]EvM=̯S7_tDg\}ƍ7\p |u?OS5Tl&E)m&ZI}Ӓ6nZ??vrR-wjB縗۷B[*|-/_LrFo&owvxi8BFo"(n?Q4Wqߟ~_ ]EF@ۉ?uAk-Fq֭)nU4xCn}k?IJ? (zJan?nZ籠`ii?KZv;? # Ch$6钂`F BDnHelD8 ?):O Y :SZfTx c Cu]F_\sVEk?'? mH&d?ji'X8Ѓ\?V%A m Y^y,J?swtdR_?_Vk`?"~NV?}uB\?ҿaS*A"dE\ϒE!S6Y ˼LP4: lSh?j`Up֖E???(?.d @  L]kk;NI=jK?y2?ꀱ@ ιs]M["@k -?,R +m?[wYga~qdҜ40_Gu\:d ,޹s~_n "+ ?GxjS`ָb6Mv֒OꛖvӒe{`rҺ}R dh~Zw>W_ }f7nC?~uqo#*?"PZT.\%B[?H8"QL$DZ"Rȁ<{c?Jt)S7Y-"Hh%kGGW?3a+.^| C9pˏAGg8?oQ/~6 JϢuSE6@C`JvݠQF7LGG :]~UۀMTIf- {NnGѭBqEe4zC)sY?ҏ\h3Ur ?ob'i1$/wqyRv?E?q@LB],t ʿP_ G٫Lf=$o ?>8iʵstz ybbaS +?D60ST/cYIANzXG\撡@8 YIAkUՐBu]?*[z[޹?Ep ע^2:"u"W/II!0?[GzI*v?LU@QݑXsvd2!P?W8ASgU|xJb5qr'?IOIۨa=[KYXgJ*5eU?]LD=b>L ?y4D/%vO弯ρE^|?g!kʄq+?ާNgno_R;BZzs%ϹOۓ?ޓI'?yyX ????r+W'BB?!O ݾuK!ٶ?vT#HM4|7?^^o?za18pަ?A,k|vo0mR]E?{Ui?lG?ꠃQX?Q@o!?QMD͐VK??? ϘA+bg?l?*W@!/?תgO^1o]|W`jv;&?kaZc3͘C(TQ=Iyay,Uuɨ7R:𓫙KLEca3 s [ SMQ eYj+;k}??u]hе¶Ցl]Y[R:5NveS!IRN*hӪq Oz~LuI5?MI¬ UJ??`-JC *jI?kf$L:?X3AV*¼\?O?ZϪêOO@Dy)X0ӭ˜d_n?݃ 8{͛ڵk/—S!??|ams]{oW]=y{ӧֿm*7L#p/k|y̙hl\H_I7y7~v?_ww~]gy? ~2Mn|hA; G'k?qfj '~0 %7yփ^Yo>?8ЎLcUjf3h*$?(zz?%ydz??ɱv?;??r<fVe's;u)|s܌?UjXT`Ko.%f;T?w 9GY⭖?q=ESA[Q\XiW/Z6aY+ ʁUT%?k8;6K>rz{НkD8VNENBصop֍ktb?]g l#1z+{W_2eCH}y[ <?m6uZtFEaԪe8S֩:'fx#S kbS|U=eOsd}JսeF?X*T]꣬?a??GAsfP8M A=5rLLQ??QgOb;Dq݃h|l;ZZ?3}չ~ UpWɣkǽ_pLm>= 9ZZƳw}Nh]?9?d."݋<}g_^??]ܾK^? h 3? mTWN̛{wW0caY?H[3cZO IFd?ז`dI>??ڮ8n?mFgGEV0K?)}|?-dFhR\E I?f^b??e׭[YHI m D4Jc0?q >G`??A?!Z0,H( xc3tqHנ5K?EqH( bP~Ʋ?~ KI@g?sAtm: Y ;?:@5(л {cEm3aܺL s)Q\\`?\Qҳ??LQ,,,qqq~Ph?ٞBOԟs= {BtKHg[`wOT@Ƨ_.!?%uX-*?&? ?–;wHZnެq/-BK]]Yj||dtnCGzjJ?Yk.]qu?哃mWOTv|?V7nybu5xmG||r}ߺqgyO!)QSZ&nH)fdܥ*xMclϹFtE?Ks=՜=?siQBլKI%*E'?9ɤefd*[?SL??m"A,p5?EPߎ4$(?r35]fs~E z0f=?b?4Zc?}NsFArIyʑ? ,?B,1x 7uAfDkM5i2S$Z19˔ 9ၞ[ݧuu{Pӷ;w\=;qag{9BgWi<W#٩ۉ둛UFߎ~fr{G#CR42fsg85xqi]?*\ %Vtuh7IB|M???pqCCb<:s~`/\orݱ)?q?ǥ}yv?O;ȆPG  !tr6y? t?: Ft-cfqe?ѣ?̆aCz?-jTS T? ٠^SSST|= P߶mş$~Ek*!_{?ndxlK}=lYXۃ>h)(OjܿzO@kXq_)[YlUVoN?ob뵎滷SrrȤR)M?Az?4=Mtgo1wT|Su%pB tzZC?@k\5jGz:f=hln?}iZtuiO[;O޸?xk&.G7CԘYjdnjPA, 68?0up7и)0 Cln" mbySFzZKq ?=97}nbݙ;y\ %h[KjSk@s?h9=2,3C挬괭l-f'leڑ?iIB»L:1+5Sq#YrFTtl(rkvNw7xWM'*?T?9?8}Jj?^y*V5l~fbڟ]So>߿XQrbE7[vǵ?yCz??FQEpܱ?X^ޫ?kFroct yK1Gޚk̹ϓw?:5?m4Su=AnX_l?p]NbQz(?¢`ED?I,@?A?HD ^E?,a?쐮M黭{%,?uAf k?ӫ"鶜ӆ³s={*nW ʟ:(/hIxw'J-4Rm ԍA5@k1B ?~t?֝ O c'Ƣazi}} ?#?Wʙl+Um=|S]]߻4>E׭s?M;&)??;? K,cw?|s?gcajnJ7j!m=J7h;VdZ_4bsx~ml{`\4 VS.BqF}?=å4?]"3GQMAэp*#ܠ gȚau?c??rë ݪEgykyTcl{Ɯ.yAږ?ޮK?'n͛VD%VZ?t g??~ zfAC4P  1t-Ef3L( }?Ӱ8RC ,?EBWEh)?ˁvO_;AA " Dj,?؉B/eXSDx; RzóC?O3C??_f ??+: pBYYds?rqB?!Q ޽{2 HJSK0J8?T 50 UB>T)]/-TZpi] U0`CS8?WMouZSH^]m 3Cf?#>0EC2EA?Jv?DEpAG}?u.H!.{z?92ԣ-)TKSkU?U[-Y Ɯds^J?PhʍFulΤh̿`go*?_MAW96л:3|ulppE?`3#0`1CG8 ?\x?ti]z^>pzd]McJ;XWpNaLLJf7憷ejύȏg?dp? \xK}gfSŮ:hgPڬ8A }.f|gI8b4"N|seeڪSLT?4 ??c%d[gʵsUK E -ts5VSF'wU,?OK%򡢄 wvf#%Cyʠ?dD?.GK2]fxSFx# D?euauit8֐Vz?DewI2_/x;/(jŌU+%J\?%)k M K?+<d81UYQ?i< *?K틪GCF /}'{bgGsSPO]-I=PWѺAT}ː} EC# c 4.`&E P,Cr~?K ji(?-^\EZ?qB{J@Qc?,N헟 E333O??""";&)HPLLLְǏa B: h+BZ T G?Jȇ* =O?ZC+JoooKSX \Z G}!Zkj? Ɩ S8V~d{~2EK (X^\&?8XE?pjhE=,]ʹa[ojh?nۤl׬MUR+t_gOiyeʘu5"I4+F DETSbL??1x#@tnU?ylmma߆Ծfʷ~o{p?RGIͅp4ɲZj\cAb3*-t5pˌ}mپ\s쬻wm Ǝvcp9Q8}ǻ oCאUƂ{qp>aTn?l ȷuڸkAoNTPx 憩K@ I_;2??~Gpb޽{wi}Y?XZ''0`dP.a6V0??_i?<{ ?55zET!39)?H9| Ԅ|ƾiwln??YƇJFn%3(OVN?UPYdtF*?/?/In?c&XIM,`E7]L/~ nidoixfq[CƢ{{^F6?{玩Vާ\^ToTQm`mZkb=mIiH{OyKͨ&ME[񼄬gY$#?/BFh*VIJ&I^@j_o.T5g?z+SL1'JsoR?i/jř}>aP]^oԘs=-?ԨI5op>-ecQqdU0z:-_Q_;?jcd-IhuCvW!:0JFs|l՞?Ӭp??bkAuhU:UNKsQ-~na18mfvkesq]_WӦkN ?巺zA*+A~Z]zf?zj?'?+B}v ;QGcQ?W+S\Te\ˍVТ$mIϊSwGӍ?}ӋqseƹW?~5G݁`H )J̏ z ?fB?< J{,1:\pa?i`9x@@gE s4P:cݰ1 nnV?px<??!EC B? 4qqC{w?? ?arYO?]Oџ?o߾?>|N??GS"D\.?##OC$J?e?:aZ_a!ߏ@Op0~ +_-܅!~<j~?~ @??7ϟrn?W#n6]0r^)B:Ji?E]B$CU|oiKӚ (d9떂}[N&7efzM֖?՗x?PEX;KoC?[p0:ik;?4W)Q@03 6b0Cf2f?`Sgkm L[5vMEjYEo~~E赯&j|:ι^lRXDñ*۫Jɲh^`|ْmV@YIDc]~A7+` #tG=iv+?nC۵jv`]N`UƝƜ;lit?A+?W$?0U%i y#?8n?y?IℿG"?fdӓoC?+ʼQHI BkrSDSC?q92i[ߝS?:ˊ~oeȺ6bnNNN?̡qao 0]>F&ځqhg?>]m[K,;$2mZ/ӕIA?(Mf?$ޖg)A4ZC;-LZ7G֙MW?~+?䜰)D?2Ѣzsgfdwujp"ۮ˱Z]Ɂ}ѓKJ^ ^C =9^R%zA`$  ,g a^PfعSɟ,EkZ_ya9QI =-a X=?)ZrL]y0p XE ަ)?ßpÀap)ۓgH% ׹8Ss =]8vO?tq cPO~?׿K)_ >/pvss_IooVo?!`~]&i ?Pam9/`G^ T|^Zz?!E⯴Ok?םAÇ_ʀy~JP4?RvLN{{:vaJ3| !WLO?HDFHQU,mdAS_$/L?H'+ =vAbg~a4s6QZ[ArNx/\??vW^mj]U9XtJ ?1^w8QxUcX???MyC,{œvy;c;vp\GVrb2myi?c_Q˧c?mE$_2!.CƧwpCڹ!?BU bs5$+K?YŬce\??4?[X] CnTs??q) q -??~:%K?L}μ ~zI wSqǮ`S`?/ ŨG$zv?PJpGt 4{ނ(ZipFItR<֤CO]`/ԉE? t mEnpZB`.'zJǏ޽??B?\9>/͛7|}???--|] YM@[#0㥦|vv -$ѧW??ϯU? ?? c:P?nF|woY`lo-ONe3?RnfA?QF?#^(L/I{?+S'LQj ֣ci)?98\?cJM&&+\nb?lf?l̢7q}Eq=?Cu攓_W M꧈ҢZ?RD]?p}jxf ZI%_k:v?ܝ~j\I?3DâhX]at?Bڛ<л6$cݓC_gOMei? qkFP Dv4??a?a a D f{zN3COW?؏|'jaʯNݺ˹YnΕޢ⨮݅}ZVŎ7ݘnNtKWqc?y^p~$Mnt_vTj 3f 3zu1ju+SyڢaeXgQZ?MM?n->__0\o ypoǵ;vBnsh0#_81^L{1(/^ tC! "_9ߑXE D:Q?Q`)rC|"|?e?yuasrFrwu@u󡮩z񾶱Xxo?GS}A\ ;&L ?!&HzD&K6\ Dˆqh XDRZd?y0??'23(ې Lj,oı>,!AL !(K?NpĀD`^ȉ%i%rj 8琗E|s~`/77XV?s4MS P?u$p8"p?77yx'qiHRprO?? y?3C33G2uuiWC}H~?2gZlVjcc~v?=6 //FqjRYb?V?=N!\.\W_UWiWhʋSގn_iʾyV[AZK~bkU坋Jٹ3 4g]?Y_yk?G?PU/V) (?{>T鞪mu]v_rup\ik&[VX}EfjZ^QTV,+7I]C>!?ӧ?Z'&[Y?R_d޽ ?r$a#2ܸv91[(?.? 3O6~{ρm|n?{ J)ˑfVfV夔e%UȓY1yW[JRl+\۔_ǐjNL8BCڥygMQmQ@Km9ѪqwƨG*o;sWnh?j~m?h9t͞\>5~kP,.M8Lc Sũ}Űjt7Lpu?o-͘ WK[5~pA?MCŁ'/ۍ?T5SZW^崺إ4?N=xZ;Q5pYhzKRS7ө֕d$i3d2ۙ7 {}$?i &hQqj?e(?>]ύnL?`!?x?I TL8 a%-SZKK kLaq@? ?T $C"Ăc"Ry&'6?r?JCPi4](pp 8ڦ"Rqmcmg{ffxHZ)W8pldSU OOc??yL?L(suUji75MfLk.$TRWRF:lr>\0U,MUEKTJ̬jff6787%L| t p=tM?.6*Iں?vbocCܜze>9u>^Y$ LZ_Kc& ߕ.qVm&P`c= &s[ l\ 9pI@8jKԧ%.Ep Gf\:5/簴q;=bѬUئ03jj}?E}jEQy????֐jee!+D@[enua&/g"˙3H(N?c~ DŠ)4#3 dkKѰ Z?uE /i_Y~|9)GHkkmYѡWGǏc\Coz?Rs7{~t&zɶC϶4kݻ?R?n$z`{gmuU'Sնd讪_\Ϫ;^zg}uG]e{ն]~T]Ug}egN??mNutM];빰p݋kʽ샏;?wAulX~}Wg&ԙԨ17?c?k$gDܜgBLFrLƕi%>?&&G3ñ鑻ppɑၙCCs?c}3Cckx݃ {:E{;ףG.}z[=?t;}rqjvbjLKJTGZۖWIs8Up=Qʹvu?G=~9{ʑKqs I ^A^Q:% w}a&FVk8W%Vad1#C4 LLC3MW?I&wȁМeA_] Y?@??B`ÐEcutNAO.cciЋ4O?vޱ ?FJHҘiL8@} Vp̢Ļe02Nsyn^??K?9qlcx֭[O?ZeC~m iЀ2Q&@&?ar?Wܗ3L˙ჽkK 78Z |/hGճgBloo_[ZwGnڴia i;‘f{}JH>kHh]e3k{?ʑᖚ 4ոF?6hG_2U?j2wڥӭMF^:=^:uPñZl{?;[p*zH]#[nmT7ͭMv#۫O?醚3~ق޾{sGծ쫺ppۙ{KW{nkw)#Q}aNNYi;=k-L4K??uUhix=y'`Uih9EfU|LO?3V&WD6dʳiNX'Ʋ[KKؙ #)N".2)@d6MbhzzLK>?7:$ Nfze-Cc=Z&n7 ]?@k8^j?L?dy{,w}IWOBE0!}?仈rn0ј?yftdKG ԁ}a]?:9R"HX%:&XAyCy6&Xa%=iȢC}S?y^wcE9?+Wv̶?!- +\0 c}?Y$n;?Igb1??Praj)?Cr??_z?]HfpHO ;_اEYgV& ?mf?hTV(@bnkny ?hM-<\?veeBC?/_[[kWG_H_lyͻ~_﹪ PSG?T?ұP 6(q!t-eNŪ s?ϯ{ô錎Kk` #{>{?|֦ΟlygO wm{nSFZsٶ;~<6k{ҵjƎkǷ|G?c玗jK^}?tϺ{^?y?o?O?1Q&T?PӐ\BtɃA`;sZ-^52]K&^t*rKؘo;C?h@?NOmbl@$s.! )JjMu??@kVYmi`xoc?#3*)sW?>x?}رcn;߶-zU&4.x?mɢEZcZmh܁j"?>c?3fl{>rsD[m #;w>־HX񋴾?5O'ϝw'+c[wzmlۓ?{eݾѡ#W?pwnk8Գrk=r#~r'Vy};?=X[r ox}Sԉw>?}Ԙ8mTMh:dU\ҍ. gIPt ?[AsXK?Պ_ Y)f| E?̕?Nw:X1.R qu!?mڹ҃=<ˢ ffx!qܒ??TiHVx%.?ۀn,/ FªT?ff HS?q~LʜALeQ^u?Hvô? q,rhhS#HM4KBP?O6&G"7g ْ<wI??[s@MkgqrxˢyE3O*f6 7*"g/>]iɘuTar yY:CM@t̟KC􌜎w/JRtpNQe/5ؒ p9e&?gRqr4ޖkre IV?6:>{2Nt$\LSn_|5?Ϸ_S/W_}u1j yt-Y}Iz!Ϯ?ό\|?U@R?Cクa]HEZynZ_[n֭?0K\9uj7UWGP4㙍{05n?A"s?]?7=1y擏O䱣?o}CV׾V t?=pOv,۲zc+oy|7O_K{w?<ʃ%n[<Ϝ&ΪsO?JUU#kL7z>֚PQK$1APMkt[Zkȭ?*ʓZ:qdU?d:u }btq1)Qc\ C&j@@ ^EvF^&K[?L?Ea?2?C؛8qP?I'M8p`$d?z!wdfa]?2 ?$3FE&?Sh'!qN؟Yk2TVŊM\^̜Z΍? ك I)DfTދ?39gw.z}ƺk #;w>X/GF?fag9?iOML^:{G?hݚnhپW׷wiX/ƪ}IKcƂEܮ?-*KJ 4H@ ?˺² ("쟻9g{ĚuNNn?sf~3{{[[t/ :4C}:t>nY?{u?߾?ˇ8ѓĨj5ӘhMLƍ \4laEu ?m(,JQȓF?FhklQU?F{(BedNT n?P{@A#"<Z[īZۈJ?$ڨ\a] s\ulDE 6,ab?{d2):X?W 8-򍙛?b~+wS馕xdU*S(az OZ:C뀉Yv m u)F j8M.+G"??G{KBhssBkS8Z ?NRP??<1ef Q8z( ʁ Z)?vefڙm:6dRl?bxNtNȤNYq ' (?|n?nPS᢫W?}| f>;|6ϾsNֳiZUIK,k{V CZF)sh]js-Νq?U3c`\=;uݬ}zzEP4W~].z~^865qgc[ݹn?;vtl}Ku[imwswࡑ?OБ{{۱g=յe<}뿿G6x䱱 jcqƣ`rBk& \Pq+ ^D?nkfꙮ?BZTAD?FLMeQ3RH;l'V& BD"m?FFBZh'peꀊSJ UŊ܂"xb̠Y ?cDU6?j^?F>@K&,`ְ?OIq(+ۧ*!d zqfk?-F?Jg"{?T?q}'M"ez̦ENi)pSՒXEUb?fSJ1-EGi0nPz?U*)OSZ5% Zi?T=?V(`?j8?MȌK?V&sh95mRJ Q8?u n7@`u@kj+E*GI¥b ?ǀ2ɖYZK$\fUTV?Sj?.b&Lb)tNĄ֜C)bk?yKnqf'h~mhhh ;?-jVߪUv?ZJxCzoշgWWzVѺ?'\?Ʈ"?y ?rg&{?q5}dfD֯_ݽOߨ"Q?͎tO[}YVkNN?j?8ڕϭY{ [kUmK?Yҽ Yn|rOZ8pGzz䵽gG;uW^cC^eQ;O ?a? EQ*բ/#xc# (?$?/JAKa! `㰷D /[xYp?ʥ.\ D??s8#?Fb)kZ.'2L)i"U@"O2W:T?bR eV?3F&IEjp(VDD?K*])s,KN.%)LS%bYcj%cӸLvBլT2Ƣ +EL$o)2NU3 iof XJ&I/OiBlYF&m[{Yd QnpȀT%L&qcV&osAvͤYlCjD!NRb.9u %N/`fF2LXCL&?}/LI9 2?]f(YM?9O>vՋ-ڵk׷ʕ+_=NOO m3m&JUZ?o#?=ξgOMj 8ߡ VњUT޹s5g  ?J?˗,]?fJdxi(kxf"Zo#[5US;Y{߶??r]˞x~Ϭç}{^}upɳg Sώ}ܩcN=svLh0y?AP Q}2n]iZ ժD5sد,?f P]B 8DnJ*?uiR"}TEA@ Iy5Jc{.*I?XE?ARZAF;g9;cUF?g?qls?IJ8 s4{C![x?~ų88KNdp#K=ZnffɁGGΞ)F< ?3??B|r Gz޷QMkST1y7_;vYw˦[KV]; U>Ȯ?0gc^}['ϯ_}'߹PO] ˓Q}2֕rsj\?eU?؎*դZkVmԴQh1UаA]tڨ ? '2 lbÊZ5u ʎuXsXŦF?C6 hEa?LpͺW\Ȣqg{z^?@B)ʽ A)??PӚ o0 ( )CidLll|yqsg??Q%?XȂ hpk q49>s? E% BGZCn%J?0OġýEXl?{WQҸ/?ES?Vpn3\Ah?qH׈?)[=zrƷ^Һ\ʡ(8 KR}cgKL-?L!?8x8?ip]ICC_\ϛ7 r.3yD˦???|٤frb߻Z?i=廿Xζ nnq;ukR[R~c5on۰׵??mC O>?}]v?v??4hG?U,:-Qr?hch]d˓вMLk ֠5/ bZGVܜAb?r y1$EۡԒ|7UP4mC?w">Δkv "T?вp&$b?^DҰwq4V?Jѹ CcqudTSK'v]"\۞#??sVh0v@x`|;y ?x?G?]xѢsv}nh뒯G*+WO ?N[liR:~R$hed?ك?gΜBZ7? `֭Y?7xD%[%~dϘ1?H_y--5~^=GuLfFMp8j0CWkر5??1/i=}kFl܂Xy۾`[Jٻ'ڳv9h եկ?T?t|zz@_m@vrʳb?Q5??cq+#y8?XeO`;Hnň[Z?BCPI&)Y0U ESZ f2>?s;(16.t :jW&K?E5]n Ҳ"Z3+\$]¶pJ?-?: =`}?Ub*noVR P  qકAWW*'ĭ"J?Q'5 J(PSLb% >??puȊv߸KSAtevpⶡLR lٵ?;s?.lFc-<:YmAOgg2g9 Ԛ߽z7V{{>MC͑˄’Vrŋof?BBBuygϜ^`~ņp7bQGg>w<+]je% & @HA?kpxz`6e"?SBDI[dIXN?ix!Z@1m fRp5P^??C]_IJ?l1twt%Ϸpݻ7%C@Gl$Jlmm?i]?Z)Z?9ZOi?qdDJdJS? ?db??֗J K" H1m Ԁe lu@R?@?mH1P%blM1of?HH*?]\<?EJM"FWs|wh_i -O]X:޽GGFDj_=Ѧ{?mٲ?"$c񷿺͹[ CB6y͝MM|ˮ mhy]YӲsuͻ׭H~?xm sf!?|'`)3 g3n.# 9­(B ?I"k|Y/ZњyR C?DkP9J8$>)T$? H?+^om(ڇ?YH Mi?\wn1û9tˊUi/DP?c Ak?HYp JD}A_y4*ħ `?_k;&N?޼EZ%?K?_<> 4[3U E??3Çek? zՄyѢ)?DpNcϱdQBrۡA?H?Zs{?zO?ߠ@9|2,ׇǏ_ֺ?D\UUW,OL?֮}HmKtlPH?dRWl]?%gMM?B_z{B F`{Nj$N qx$?T*hӭ`e] <:9:6"Z8kQ H5 ,>JEH@づ>Q/dtέR8h'Q"97X?KyY*O|?}k?22ç?=twf͚5iҤti c/??n ?X^o뉖冖---c_O+xti ??w86{uW?ˈ|'MM=T]ƃH.:~ Fwc~W##TTnI9%Cu:uBcGwZY<}7ξMU,jCMm??^8{k^nSn>]3)77 ŬI30 iP6TgO֒QPze%?4B.F/[XfXebխyوU 0e y* p;Xjc Wlʔ)?̭}셓絴ܸzGu vGG:֬ ?v?S'COzK!o֭UⵒXƤ\F l,#c) m-ZyMrU?E?*05bCX:]?T??ZXpJb8 ]g/?Ec?}e2qH]]]?I}v}ZEt@? a'{]MrNe54kEV7BPuɒCF0?m4r wmPD+ѵihQtX[A#y?H=ZZ gH%k*],z`߻//^g}?n!@UE{Z cH??yA ?*10_TǴN` }-ON|Wmo/?yԨAٳ7V|ؘn|ߙ;olC2b`T+ O[ h ll!?``WJ8JFB4V@Ȩ?Z]D&t:p?"O(U$?3N8VKlU%vT*ti@x551vl|m ?\06?F&@TpP MGx`y̜/YUUje ,X?oN4B⊦jo?s`~?a̵9ZڲefffNaik׮pjjJ????L2D? l^Gıck?uee?MT"DW 5vWt겲r5/Fa/Ο9qzdh G^\ϡ[!-~Ғ{BJ!ISp ^Dk_XK?ٺup?S?pC PDSB/8 %K *m%*уB. Ns?](I1@n?9(ZIlj)?g&gǞ_1Ο͵AQݮgt2N&SI{{{箨L`gkkkچʺu DruŎDTE_lfkďS5KU~+Cׯ\yfdc̞ť43??? M?` ͐[!˄ `(a* .w`ik Y?L_Z?z ??ta{NءR*fCVYB肬Ke?s ' KP4+DG>nlE&YPZYb9i]>w?o)VXNlDJX?q\? bɜK$߻{cG[[Z}MDrBx.ӏJnf(RV(Gdž>>tEmKeQX%eX kLp円U N7ÅbNeT ??VXӡaYCőq~n,X I.&%,Ji\`nxUB昭--:mnj2GFh*h,?y?:;1ˤePXg#.?/Xvy֕EL[D_tPmay,yIVT -|jŁd cMrXj*IxK_@ȇ"S҄}㳧Q1ҚFFd2AϠGq7nH?G~X \=x@ݻwԗ??93?333qf:j)EAg+S/?ϛ7/1G=Iq^͌q ? )mfqHOO 4x<ۧ"?|֭h|۽/&N?ӦcұcJ 61jgFnwu?mN֮ߜXoloز?Wk;׶׼?+:*^YU?YrkkwTbю764f߯ϟ§Ct fftPwiFP܇tCǡ] BS˗-;wu|Uɪ`E QۢCImqx4???P5@Ҧ%YTL!Ӏs_ycwU???A?BkFSV-U>s/&s ޕYmqc?wNHstށdO ?vkWuuuzLKcHlV؁{Qk; #5Ce"a^,cr4CC vSpJh? DjqIA? ]P?rCN R[T!?O|y???J?EZ¬z{Z2+DZ*j?iVsvi}f. `yZg%u>_s'^ڇo?3_#!{[xeoMMVG9zn_??>%?k0pqp? ?|λCxmvtvvmzW׵u-},ױbaE] [Wھ|իѝ??{?KELڰ?cZ6p1"!вK&*ka0?d%Iv4DԂMzP0f@@@ I Tfn"[ pRC_U 2+VnT"?6f " @#?k8ʎR,?MOhmNjEI?z!:$3#A w.AdYcvL?SA?!К}Euu)s?Ư=A 6BٲySKabW?ˑjfPt\quuӵ75Smmo/.I_xֈۡcǂV;Isӗ?>88MB8 Lؽ]?Td_?aPhppYaZo?[J}=;wFejH?JHsc c2?f%-tZ?v3b?͛bJ:p%y-BOb%fc8E_H V!j?vI+I2 r_sS4_T<6OYi^?eKZpGl?1lԜuZϼ?(It?otoyš/5Ŧ~gnlk{U?uAws֦~Wo^{9?Di9.q%@?|z-<JS6 ck??6CM%p |teFK*e*A܅*. ֦RbEƤ/+QF;?bX;rC$SJym\`-="wq9`"x.%B{2n¶ CM!UVp8LbxJc𵵵Ӵ>K*c@: %,l9Gw!Q fiM?}zE͞9? DwXgϯmB_YԂ_t[׮??R W… z|FZ_ :: tu544cGq?cН'/^c@|X$\Zj%ld@}fJiZd s/_ ӂ:K/F/]$AzRvhC ?j[LJb.S#EA$ 6B?_ be?=?\t?RK ZHtՄ?6 l.@B'LEty?^ H|4|ҥ?dFq}şh^yZ{'ur\a%3䲴঱|> -Ykjj2zU^jf?̦Y]3Of6J?.@̖%c⫙İʾ ym1F;rٕզtIkR4>?D$u6WGjjS"|$BT$g8wRMipք]ன][:mr,ӄѱ;׮\ շe?{w[s?}-ó}+/ߑoغfY z7?qdߕݸ>rgfiFwz? e|⮡RZG?H|YZZ" ;v?B!^T4%ZHRc%N9?!ROYS]ى5ⰄJ`R=]a7ԯ/t<KABkf~Xrtr ?7ϛ7?66,?#.,,.?dl9sre: 1?^'F 8;BJsh: q:v xlݰJMcԸٶ?`_pR7S+JLcsDǞ*Dbk?E3ZӺ?3mʹ? ߍaGN?\t?a?.oD1?Xx4wh[}=>?{ǻv]Ϊ_l]oxy To?ѸP˞[r  y9z{` fa^0/bE p0 ([9?xQ-`O S- 7VdbLE\QqpB ?4AT?v< k<'?~9 rOnHh"EqNƋȷ茕 D3ڙ .:Tg? NHs?К$bdFk?~kmق^6/DNk5M0wՆq?Omp=u?t?JK`Pl?% ?x?\p!nhX~m]u `mm6&?OWϩh?ۻz ?P9H,uO)Z74cyMbd^aۛlo,HWF9RӲj|={w]QCw-:s6f8~-vy?c?Y?`pnT/]e{?f?wWaQn~Aihʕwn]+Z*d_kT§r4εf^`^%B*8?J R$?@@?bKOVsPz?HqLG/q dcB-f  +`ipNQCc^S?nQSۿTS4Ӟuvv=zvժU?~?yc*ȳf4T:gol҉L?CiVCYgiؾ|>*Y~y> <?ʠB{Gct|CrP^~lth<{?Ovwz?Cwo o o ?ݕW~^{y  #¢VG U>K']"\Z? ?u?(?-ӳ?"?Q/y?\ßl*d̅3??Trªvb$, hċ@ ?(J?f!,hLK1pXQ ,p+O!1d`G?cB&bf_ o_8e I&Щ˄8d?^^n\X?qk֬?gQ?EQ3UUUkQ{DXy#DB?ic#b.^Oh@HtTYyjr,щaݗ.cz8 &+?+ɬLP}]"9RHljGKhxKޖ}d?eanz:?o El Q JRn7R5S)jBKH++%i?US?E}`‹1gy;/fBT, RUuQ6HwteΙ?T(k]ۍaL?jxkm?̸=6 LTI.?mfrk mp+Ua_#BEmSWV?j?!Md}gD-Oh؞ݽ{w?j,?DmH ҆8mHg^W(:JI%z:uTPS/*(ZzfEzk֍W/-.]_\?-tϟ|•KW^Jyr+[ꤠ,hHړTb:raf80yqp<lIi4tZh ۙ2?z?@dt?FH??^ oTD ~4P߅?Ƣ+ 0N?*Bࢠj֕ɫոXF?W+1n?Z!SX]$TkJ?} BA?~4==0>xEM e/d ~+u 511WvL??99?٤Ҩ58}W_*P{ZZXx+9"b.+}o?? pA x޳v?1J~Hnjpd?= ?c܉Cd?ܼo?)`tO?`IcA?)_TD#FOpsR&Xvpu]NG@)uXyF@Bjp 'ABGj6^eVGI?ښ })$?#?l?$PituJ?)3nkB ZBdu?O_}(?n۶m]yV?iCZo?@k{ h4o|!A[?NrSJ҆DAujSn/k Rt)Q`gKTh6?8P-e??yTiVS+QUYpx- ᚩYEiC9΁" ԄuZ Y5j\T8ʠ,Uh\#Dpj<) >q S@\u2ԠG*[k4KB2 o`%g /k?LUr rʪZjiǴk̅GGqq;jAϮ|Zк\^^8wP}I58p[Z̲e˖_=lPTrG&^W\ڻ?ke6H ͟{D f 㤐pawڇª~\䕃.$w͛?o._{#6Ah g?oاxUlg;Z ^^~?Lkxˈ,FiSJB rB_r? 9 PCހDد:_@(1R񡆇zBH??B mRn Df:s^g7c"_L$c~5}+]\Z%ec;'j\t u}?w  ?v3 ?qW?lJׯmXO`? /?𑋾s䉟i?N!;iZSc.wpg}翹bůU|c?Cч?*9V܅K/-_w`SGn?礓p\!IR}g78/^?Wf{^@?J^B!kɳ yy+ot}˜۱H]\o\aՙQn|gΜٍ[[?d͘eXZ7ǍTلՍ蠵JHF7jlҩdS|/'k(@tU c]?Ma-^7tib?.CU2i C jL3?K ] L'rа Z qkZ)Uih?ۗV֒t#iD[4!hD C?`;?_?Euu CтtƺcsW׀mc~ @?:\=%!ֈD\j||ҥ^]y?!wU!"=/Isցo۲{}عcშ2GoS6.\Z:r۲'Axݻ7oڄumݼw@c쏒ۓCW6lX}[y>={?L>qѡk[q:ߝ;w` ~S_~޺w{>v-Hp]KmHCo8{?Noe#6nv}-$?gOu?~28_^rK˖^}l|32?v?X~[<)o?8+- !%3Z+:9M+9,m1-IPpuءuAZr^gJIM}:ony?11`ϯ]v޼y{l--4j5nh(oT+רWgRa|U?9uϯ?F???`8*n!F֮]Xڧr|kX,hI 1D_ thI\ $$-؋?H cQqjrig [kĚJ0,cFٱtGڟB#[S QH? [F>E,D_GoJYoۺ*y YުU?vxna=NEqI2ŸbG􌁼fFh#B6|T/; F2?xd^2ڮ?1s,bUFV;Iؙ̅FI tRG}iS?~?k"W@CzA4J%?ʭenX$sq@e\-?dmE _ zGSΰrEeݖϑ,N2N\m9 [?.3׀Y\$Y#N`\J?+ `rUgFƬ$'Ւ:IN?I\𶠚aX:2?v8--Oo?|6?4TCg? ?nhڵj:DĪ̪Qt ׺M37>K DL`???vЌ0Dݹ?4%N? Mk6GhQ`Pl#?Uɯu|zDх)JCf FDЅֹ mZM,mm˚6XB푧dLMDzّ$8,aVc;"3?FĪ5 D#?J+Tt?lGӿ[?h!%{@ѽ7eY?E?=\5Ӯ OG=WQyR]zA e?b?7"Y^e?w)#1|NoݜS`ְhBӵaB`två+¬Fo:??׾?@T?3$? &\%kRZ3Y@4 J5;`r[ I*,ƿZXࢳ_?˜8!"iHۊ$ CnqٖWjrp$ZwAnA,n n ?%Fqm\ Pr.|kg)u [ [??m#:[pewDՠ?Y#~̵`b?N#XvZ%yMlK N7֡嬥~ZWڮ["rmD2fo㺱e ^ߴ\ʚu}+cKaJ^?!߰77q kfnIHf!s FJ_Ulllsh9Mt?2QTLў??IJty;FmSt "ipQ3vzGz?~7_?}߽Oᄍv]ad??L?⮑jIPKr 3D S\0#w݁vg? zjk dS fNC)d?LK K #-, @_S6&A|@`aM)`slL*!A(NTYJ?@/3$hBR]o+P,AU9Gy1l7$E?К"C??VCE`+O2СYɼXk<) ?h\dʊT?eJacDI ԯYUn0e ]zu?K7YIWqHtZl6[p[Ji!8fi?V-A*Üтg B^\(ӬεHf?_ݤ$?/b5/vTf?#H:ۑWOLZ,GxCZ"qf02?h0> S GF?T z/P%Z?g&^UlllshYKis?e'~BF\?v,~ -u[4AY ?g$?OƳχ|o޾?r:|n?{7_ŏ|&q?qhqS?7?%Fj1>T?L5O&qkK1@RD?K 3q dAj4d|?B[G⮶?l2AŹpwffLMkĮJnԜH4?2K6?Fl0kRD3v nR?Xj*uW f??WfzbZPJ 1PUN71uQX$ %قj5(>Wۦe[#]Y_ҙ?IJ/x:_7ܰOpOܟCNvMxNx:]]rx8 ܸO#=Ůدܺ?FOޛMEv ~B``AHꕂU[Uq-zz^6͵.MY?'MYs( }5 ;Ǘlg;v_׸.uTkPKC+Y.ރy+XfF{wjzkiyDǦdnߑް%a çZ??ܭAOLYq?Hɫû#j|$Zf-6vyz@ɏ".9=DZ?>C׋bfCr B Mch6p jv+ԡm8+kP%4?_EV$o-[;G& |?Vl1!];R)?Wx/DrRZL[wBvk\; p]?`6oT4· ??m|B χ=yQ2M>??uJ?UܶxMAJ93v :dZoT gP8n^a]?S?ԷK?}ڕKpCD`׬8P}^Ռ{@T2p?Gy?u^}5tҖk׮Q}Ci97ss 3?uy۷kU5l[ںkbi) Ww?z Wtlg;ۯ[TcJY=858@Mhihvcą^,t?]v wO}os G{w?w^G0?{b|RO9x|q=?܅F60HTm?ْK{z^wQzut퐛˔_UֳZGD??]+gwLju]wYF bl b-n1?VD뮭rj?` MXGY(*f?}[ ula`r~d?HsZi2?g+:vWh^Q=?zj?d@@KhmEkok'䎙L@/qT_n?NNC?K$@e pMԍo,4Ͳ C ??,2@{\jx,fUFJ ?EeH YoɅ`^ɢ!6řVlJaf?Zoa*S}A4W&X̬^g0Kl>??$eixmp'v?N?L?bNOK>j):.q?J[.IR@a`ԽI%b?6)"~?_?7DꙸXʷm@mCKSOL jh*fXzc-6hK[\24W2MSm\:@w?hOM#o]fK}Sr'<>?~lg۷_?; VzY;Q̲?zY~Kw*ĺW]v^Y;7?BWgBÙ{7GgthQ=r?":DnFaîssancGv-V6א?VV9N#(3N=<ŅgRkĠ%W?+r fl['ViV?/rcY^0VЋ_JwbY?f]VveZ8HTF*Mpز?*5k?Ex 9?uݲYU}{]؍ cfvC?X3UtSY;XHUNPf Iah=nd{ڌBb"ȉk`O?(Wm;<JjQ3lL;3e2ƣz8?xIJ*@tF_ݢ[ͲM=/y ?0UVU>/VVEєySe g?ؔIME?q9ky +e+lNybYR*?ƦM9vd5Fl^$(`g7?SZlWPTC?ۢh)6vg XrlWaw?y\|fy Q?{ϟﻖGp{{{U< w9~~V\Ak; 3$gzI `??@Fyُf oqGcOޝvlъ?;?}vQuޏgN;?g;:QzG2T`V[w?xw?oƜ?=Aȓ'>aƻC%#?;O-mHP?NfVX?k~2 ƍRTj-V;SMT6p_t^+XOΉб8Fq? \>? 52·Ѕo ;3aBSut?Z t?nAXؐFHZ)O-v~?dEyy<@Y$5L?IۉK?l06?`wq !tSC?5SYdfCWf7U]SSuu82~{xv Oqb_{,nbb`FAgz̀p?bQ֮olJr1_ ?PlVrRU:|6˙Z!]ΑL:GQ??JΥ *MY?DT@?EZJTD)<Ɓ?Y,t? g?lCNQd2aT"lL"Gaiax4J\:MTEd2he*Jd$@D$?+d, SPQd?c` H łh={>^ x}y˸mEr^ml; j;RAO&?"ET?Df :&ݤ rIC[Q:j[zQů6o`Vu]@ݻ.纛'_ZI?q:]o7?}?Zi!xSHEjZRRlyeZU͕|B`Kퟢok?ǏܹBKYqqq?kN[ms?߿h4{OvxZG?ţGz??! ǍrSQdaE\JgcjJ@M H2 v$Gf [!!KW#y?fa Z+X}.zsIT8| sRQ.e ja ]jWzn n x,CfCC6? |g?f6X!j7 Q?*A [A?x du%?tٯc^W?v??h?Gv?jwn?jvܮUvՀ?nrBla1ӪzQ-bLvhTZ d^(Ԫt^i5F^*B?9t\dt?uP Rg |&Y+檅L)?RdLRDLD)2|Tի?Jg;?C׮]Zy{F"?|F~@8Yp^`d œy:Y'`p:??X`t(Gi?s`h|ؿχ?/?;g\?@w;?ӎ.ɰ=4<?vk z~ ۓN{N{LNo~?h5p| w 8kfyZ9m7jǧrQřiOʧqzX?)N?Z9?NiQւi ~?V,;|vFӃÃ|/dNr'=tq7KS|*B&IT,zP2K? yao"M_ !<R?ѐgT8urZ rڠ ˶bD P _{Z_҉ʵER9LƠۘp٧d0OPT&x YQxeޭ?tkM+u}Uc6Rىi P޷_۔dkB( O Xsnfc-"?۽}WK,7)VLSX"a|ke)?}CDl: It؆6?vQ?@k60Ps@iC|M |Бŋ޽|c??fK~=@pQ{8 0Ct<v`?I~\l? ?ZX;.Ԏ`.VRxT?JRqT8(灬^l7w|6DD6%T*bTKx(!?h3u&ו A,dr,Sa6wBp A?:?Xm7{( W{lFC:I?kV^v`z?5gO?R1p?aJF{)߁G=jQ?nq?8?"p g\ѹ'³Qw>wYt;?ˌGYڔO??XGc 0xiNn?IΖ?ֈsmaHY [фøK"vhG+ " AL7)D*cTGlhPGe? cU&?šT!?쪍UPM~U G)?N?|\lQnFHQ])Ԯ?6f:ZЪwzI?ZTR?`M?d3UbSZ)& ޜĤ?bk?\[ S?>?Yܦ#Z[g,z#AIaʅwp??[{`-Ƣ&?7cYHGX胝ϐhSV?ytS+nο-Nm(_?F7?`Vnܽ̿د< }5s3͒?ǎmy_$[d.klٖx 1 $0L1ITOq\?]?L7AU~a[cfe m??8S"q,kbQH%"N8V?]E@\?N/z_l6|E wڵw] ?o߾\t ܑ(t: <;;>>ONggg'3퓓gg@?f^M_8:9~`2Z{?fzMkh+4TĪXu٪k?\]? UӬ V %]$5?5?QM]|YCƐy͒@;\K2墡 ŪH(,ƓHRRJyd?`n?hhR gЪI4^"aT?X @?nJ ACnH ?  J"FtMF:) tG%aKHl{u?tTKg-XW?h?mDE6V鵤|?R/IX">m}a?lkp,0lRD<똒H:R7vCFaslVKdhmUZl:d~ֽo9V?iX|yVU)UQAaɠ-Uűz] _^?M"O S?`0Of_E_ ˲KW^}ͧO?z?=0͟rуwr~?}>~b>ezt|ꇳW\g?O`^qpdm0*0d< : RY4YUΪpoU-C?uz !_FF%Hlot"x].{Np64??dC&GZ?ښb"=ڪL /z泡e㝗O|I' ep2jj}j?mmkVS]_v&fIH?6hgy???_?Zuݻw4M_1ҍ7u;? ?h?z?Zߺu O5W?XH?R,?}f@^nz͏.>B$e2OsǓtrv~2>?9;?_L_ϏO?z]*?1H#d?;9X?~ďvx Y*2A,hV!OpZbHn*ޞ>`!}sw;{[^bVstYm 9.{vOUv?jMPh(x?bJ?/rAvQ Q۪zwC88f m >?G?fB5'١͕~Lm&uhؿ3InNfҫ[Bg/e!H)jma?Y._?l1Өz=cz?|kbaFlYYr;ҟ?F^.GBL0 XlS JI*iqy@^ ?f ~JK {|CD" BF#7].Ecc9p(?[Jd#prhS+?tÒMAwNQ^??V?cvBwRDִ%q"atsΗRh?H ̯?TljY&H K?pwaْd*q2P)dI"HF??t%bZӪh`d(|%b~,??wjIaعHӘ cgæ[???hcuRa? ^͢&f4TJi@dRԪRV`R!)]?PHKa-ґ d3S?x%siV%Cn4 <ӸЩVJa~y>reFcO|^3 ۊE `dIfX0A.{rS$I??W?`!aWDCGl+A~c ˗/}*x@`D"2۷ogϞe?|IM ?fl?[k]v??~@hZ~||9\?O&OxsC쳛Muzm2zQ<ڜNBiU?p=aOBOGjdRpgp4y{뇻}ո};N3l?J){8&?NF֐}<חePp:MS&\`ÜOD$s¤|; P+jѓ2 >p8ku}SsjOL : ow9'H`NҸк6*Jq?d3لâv-sXn l׮XkyZA& >',hԀػj2?W/_B?,? A..D.B_r]?_u~b͒P?N0hvfkJS T FZ^JZǷZ?uvwz((v8K6{u?\Qx=F?i<u+rI_ XgL ?ɠU)ey*LDVrr/?q ebFaU?DR,NeeΦ1??e?T&N THؗ$#vI?".?K0oy 1زv[uD0j?]" PZAˤ"MZ??DC>l.Țn%?xrEa[5ƕد6????G|8Od@gdkJ?6ddsfSb?PdR 8|?yቝlc W-{ J?KM?<#rkS[L>D&chp/P8 ~r T$U@MDPkaaө؊xJ.KvS&?MYEtI4G(Bs@k: ?i*8VI>}?[QMPܕ:P({_ޮ1t Xe?<߼ysMܾ}PJtS?n$ (>?~ӗzHw܁-\I޵k~[nϵ|y~<|2^&x4G?'?OǓK]`l4ڍj|\w*szZ]?>M ?`&@AtH";R rniBb?^e"4*?1tHWD>?Db&Z(0  JYjcc}C@Qlr 󭮈".W? ] ::l6l]R&e?xS}`~ŋ:m={ w$pիW?_bzz?)YN0 ~lPw??itw]r^$39Lfggb1t?o@1??.`|A>?—?_xy1: NFɥO/idOFӪR>?1x/F?qsz=oZU2?G*.ZJmpor!:NvfxZZ? J?n8?GG?$W)fnbp?Aw0BT?jl V~\/ &Vk_W l/ÔGM?PV=holq]jyfC6*ݺVL}Ӏc^o;NzQk??l9a3?&dtLNcw&(L6_Jz ?DFmG`?NVTJZ86+ Yd?ᴛz*,6wJ\5aSɥjZ{^X?OO:i ?ba;?KB^.s4WezzȈ٪M՝Ңrr، ،zUQ!Gz3?`A?jFqL^/˖Y k6 ٙ{b H7s?qY??Hziՙ \t;-  8C?CUraf d6 RPoׯKKZZ͐_'?mY?crHK??! ?mllUުlR0ؐ?Rrir?EI?t'Q}Xgѫ֖c qnI%"޶iU J?tlNOR$?^tbVGbFD?ݢ҄R!?78v2@S?@Q*"???ZLL @3sJtB!p/Mz =L~KH uɥ˨ MFd@W(RI"η*?>>'0{K>`_QoʭzI?]˞>mgaŗlf#yvoW9[ORn-bg7hԝpt XNl9?wZuɰ跔 M z- zEW( D?oV%mr^@B}dƣxYN^aRi٤V? |Sٲʝv%DJ۽`v*N;ŤɦMdPк ijZ)3:?A EǃE&UHPV \@Y:Vb?RYc)"Zf?XיjPucNdc4OM.hQO$teLY t"S+e6?8 zMZMUcEmIk6Q?f7T?B\[0 n t+V*We02DO'0ٚaLݶ?N ᕬ>2 a3ƆZ.]QpVJa]qJL:?.DDqbҩ=g16//?%+: z73EbA|q??y$Qs{Gq@ Wo޾}rnܸ1Zx `C~i?|5K @~@g9u3Y?9^~ 8ZC N]vWhj\ 'f~s /7}u/`xP/oӃa{2==;=Fѳ||z6>>=>?9ʴT?T?G͒7 gOw?uK8ێF5"uK8M 0j qߠϱ???p:Sy^A0Ǣa !.mkYTBiӤxۛe۫1\Qj>?iUV%3?IVTj(TP,)RiP)f)>!ӪX-*8S(ZM.Uf^̥MG¨ yִC(CҍJʨW )cQ_By?֨2OKżJ)/Do?Ɗe(2?j-/?PѠɥJ9Tc3ž)rVQp\?=ը?L⸋&Y]d<4?7#4*b?*2|=Wb&',gȻwo??XT4z4 Nt"yMh``{].-``Q0JbsF?Ki:BBwqyq:PA??JVq_?I|pU2c9XH.vif5XO|R'g}?KI*5qU2j?n/?b!IdhP.<6v]6C! ZC.VV TމTjr<L!{{6}9ZKn?,?㙘fh?qh"ѭMaDV.aX^ģi4?υ?{ :rv=E\.\*akEhXJ)e1DA q1TjLqX$ΔĢ hh?~g?b!XX+gl\N[*?x4SnvRCX17hb)_ZH\[[{j4Ko\v DXի ? c~LZ?^ ?4?/`}WwAlD)js7o^|Olv 柁 _M+\t_{?Y,ώAΫ??????~zv{ #OW+x7_nUN ?t?[ Wɟ?==Zxc<^AyxF|kyTM̧xK(?? ? R)f北KE?7? Of@Ѳa$p?h%b!ߠM%bU]m?VUoo\F뵬X,Zgk%KC#sjW IL:"Ttnc+ߧ:ڽ8sr `!Sј_$dww 4R??BeɠojC>4_[e+4E?JL6l&ީy,M?vII( D̷?,VĢ \Lg3E?\*v( D:qۍ:?">j) 9E"U?ID&rX5Y4h? ɐǦS^'ǒ|ch*?Xd["tkJRTqG&nKUpmb<s߹s? PxO?F?mx9Oɱ9dMq&Ė%wk߬ک]"%(mK^eM:s?EO9c4?(ď?~?&]6T!?{wo@&kx:?rToR>?KFR1ݠȉT4pܿ'"A] X' ),?QJ=Lۚ<GRJ?J)B#.,*e~N^xȣKs`T*y|V?d\﷮ރ~Ub| ^052?dICW??d ? scQ)/GDn1 d!aG ]-D ?Y:2KBA<ڨ`adApҸ)~DdCjKC;T?.N?TBk U_ G0/^,--}qe7`$իk˗@,?Hb?PqO?o@tvx \8?)h!nP;(EQ??/Ň c^\\|xpufÃtqx~~p? VԺbQhղg3|?9?>^M' 8-Q{ԣlVcF=Z?vZ|ډ!4R.?~kƝQTnvz^>{^|oP) ˖ dܛ͆R?Ĺ7el6-ԦfLk4Ny0h?¼wɰ?L7?c>L4?Vo%WiD̳5 pl u) zz R:lk5ȢH?A?µpP?l7I??8?G?ڪbTp Q[mzVX*`ml]7WvkV`0b  ;l^dN+ VWxU,(l6zKX}oZN-)f IATӉi?K -+wM M2Cdcw\Kwr2 VuZ [,j|Q#JO&޳ɠRI?ŢJ"M[>(xlGUJL5#hԿ`?ch̫K*? ?2!Mg1ie<pj, h֠ѝ\?|n3YBm[/a08% C*o e?afÂR.̣lDG?2a7?mZ-r YZ^Z6 C>_IU Q!%ހY,FCt٧}֟MEaŷ T_WBT^6.], ).Fz{I DŽ5h׀s?sl ?o?̏D"r |܀?={v?iN^ǡЄLx/?hugLJ?.l?fi q1%It?ZLNϏ',]x]G5Tf۪%u]+O?`_Q4lMQLFܠ4BvX??ZI`( yYgC?FxV:6gT*b.Ðzno2%V4w*2?n5֪ xlVP7Lr!ox?nPv,tDĸ ~i2(MՈ-zbD[T"4&?? ZkN].e=:xB?IT% k[,?Yso^%Z͢T" :wط.PbFvdZL^]?Jw\vߡ6ːg?N)yisl&>t)|Ôzw yna\]Q)7{\1vجm i}?X_X?{m-?Yo|??I&NرȲ]Vj'Y%Q"EJ"%ʤDIɎ{0("|?Bb& i&SC0=yk ڵ@c~ɸKSFx=4B R1F?DJ?U1eݻ73X0 z5CŃǡVD2-CdRȞfCVrXeZLDl&It{;OF5]L>XF z Z !"{Y If??ޝ??]N[~ZB!wrpZxV?lz]ñ?}rGF0qtt!Du{[Mhw6"Agrp&mVΤPQOM-PUFþ|;kE&@1f3? vLjٯvzzD;l@ϟ ^?@8LoX\xQşׯg.dGd0>ĺPYP0<\meeFN4mrg~W?/'%pv"ogC?- ??_ S:L>i_˗t>ft8ZOON9/G@׋@>llW`m]'D_`Nә|<.z'G Q[rZvYi4Jk|xnZTzhS?cpGbzGl]k[x$;5[KӉh<0TT*tCQ?YߓJ_;FCHBc4`hn7)?˒e+ڽX8vUPm?Ş?NSz\Y-}U*u]Yl(=a35R_nMxk),l1?QZplSgwJa6l\?Ya!˧SqpMٴ4%i6*e\a xZ dYJP[WBA?_WKV/ m}tϝvl6sF8?akQDr]u{@noo<9I`D6mPzzJ?L\.s$ ?[A\k6]R vD"^0JP۷iTt2g(t&bn]oTscMxbޅB>n2C~D6K#[tAVvPd*]pf?ǝ=E˖X t`IL3Ѱ H"u|?=Jqi?tq/YH9FB>a8/pf?7դZao֚ttҼSЭWB?^ְhKTYWwDU4FQۚգސDiP~pNt0dU?v*+,?:Gw^y\z?h߮H?߫b Ӗt7W?QxAb?gn- [2QRi?1?,,?vfVٮ̒@В???EV@QSZRhSun Ӥ2 E??:yG{ Xڒи]?Mw*o(lr??y_zgI>/K?oF`B_#|A0t:?`KKK|?va~??Ϲ?"[|\cy⁹x]>\4s|7{d? LQ+p1? Z c7w3I?4?d?Zn4ZWDhGցNoN7gɳi0 ^?/?|*~$0a?N3*?ڇf= Al&Z4]Y??aQFAV:,>S$r!NRަԯ׊QEvggu؆UOG\qh?^uqϒŃ-P_;(ܿ-rCq?q쥱?ˋxކ+jvmqq ٬D:b'QhvHmHӭ?۶hMd{I Xch-x?3W\9::?90Hi?&Rd?7. ]B`?]70ÿG~.p~0A?3?ki?b_Tz: N?kNi:Rz@½,yOSzX.DآʄGqAM;v}c}5Ȉ}Y{[o*`(qz螭Ǐ\K;rgd*L`J觾F9AS7qL/ ?G? ?vų?j6Mֶ?pVc[Y瑇ҡ׭K?Idg!!FF[ilFCc⼥@50vh)x&茫 ??YU?.sCÖoei K,yI?Ä0Lsfz ̄tӖͲ,n~?ْvwWJeXL(HHVtQ?Jttw$}ݦk)*???wtL LnZt]ou7zq??7WW.ģK,N-u]wYnKa$NᵵKY"Y8 meDѽo^?-@$?0CDңT0Os4q߾}?P$u4LX؃ʮuk?q?u?`d?m?%s̨dE\[bkֺoĮp^~Ou L'2PxK\Vj?`O4 G?P? 'Nq?j xi?W^__?? BNBpta<?WW A;vٳgWqvÙo޼a?Z}Ę8>rZÓp?I/ D)`kGS?+@UpioWyx 8~}B^$IqƓq^UVeTe2)2Df uI9Cz74$8*qęfn?i:/#E,Q$tj?e:?`^Y?˶"K ͪxXDtsoJ?lMlb?EUWE/b[s[MYTs4P?`^ b^i6-jLFAysӭ?qUOFqcN?qH&YP?! ?iGv w" a֭kP?B'VI#/v>d Ov8gؒ|3}iv|Bi|~Foe$1CHEM"wAZEV?\?%?еPMʰt?\OmiB 9*RjCR=zw]BG2Kh ׈i?F?^isǛd?pum]ڔ|n1֔?׮^y?6$ޖhW;!j?˛кjc`T*2+s92T&oc"?xo~-uj@W?eFA?Zwpg@/Nr?(TUK \k?/f_-? tֵk%bls?2j?8꟢lpΙ3gȳgπH`8wVy?677?_U =H&[nf?7IE]9W$?ׯ_]JS֋ kG?,?Ǐ;}?n5 I_y}nV{Eu?eNlZ2*EUE}YbV͉?I0?kZ*aC0?I8^Nn1Y̦!@/tG6 )4T"Gɼ?6?o~lQ{ePǿ@UWA9"{er(؛?{{fFҖ?Gav}wb/sqO7761I|yeUiX&?quA?,Bi?EQȳ] yf ?l n??W6Ah*Pg*?> UͳJ?{VYd!tb#jI0t ޝvsu?-Gny`gz?2*yPcթc?@5E7=I?kk[a[BwLx(;zUTqG?춟(ȪHk(\CnAMUd[J䩧??se?D?2pXTЁ^{ !<M"kI8 sAǕ,Z}o v??!NCln OUU*VkbRVݕzwGJyҗ?ܸ!|YGљUZp7ls5pW c.ӺHنT{XvP8(o?j >K,|6bTG?S)̀1Ƹ~_jZ﷮tZ~1H?dzcɂeW?ؤROGW^]oU׎Σ>ż1%p:nȘRtے{5Ď6?l^H?_?{᷿W쵖c 6e]Hw[|y?\^뭫ucmIytG?^SL]eؚub|ŧ k~p<qW^G?½,ÍjU+҃ nbjF? A7!?#4 o1B_ӳ:L.Vƶ-tI0]mQ-Q?/_nܸ .oQ6 h!}P\renBf>H9? Զ׽7.CC^whKu9={/|o>q.Eh >TyyYu?‘e!gqStj0mCe4Q{ ;JǛ b+2gJXש ? 8'Ee\rOYDqEfGvij?)b?єO jʠiH?b #aUȜ:Xk?TbGXc0Ʀa?ʹ׻{ hݯbSۃAQb1!e÷0n kvash}}?Ei q'Nj̅}B0(DZܿPYpF)@ .--a9Hm DJfX?908Ui!Sa :^?4wf^?] ?FsyjSsF9S?g9gc,c4???%S-m}m̝?qg^k6VG*ȣ<)Y|F?nI}ДEV%1Pb`&wJ߾?qsW)"q9Swԇ^}3?OmGx.xH([Ǒ#  CbEJ@ {LU]}>bnr .x?^%Dꮩ꫞Q2%2e u dekW\d?y(V&$ܨo?ћN*?g'\+WyX"KHƮF\w3K?DO'e^QN;  rñӲKQ? j!+ L{Ơʙ?s;? 5ƵcUW#.h{;̶bj1bc;NNN r5XЖ-B(Z]ɦԝ]*\mVp#&5S߻CmPBki̬qi϶}RCzC0hڕ^k g96j}WR 03"3zf>2جW?WWN?MQy9c},7ŞQB.]U|Mi˗Zcnny~>̳~?WӰ:vuNp?~b?@/~~c T>rn>Nl͛7_MJx?w?xeee?T7/i /+??ya?ݳ|AïO_uW_?⼈ieUEVXešk#SHaFM:RUIWNdR-|o B[,bZ* 5)bn qzU \h|'3'c?u?3~MNI??V ??质;Bh*J^Y ?-c2I=$F ?f~z8fIr3dNI?m]1T@uO;fL?M M <#$HL̄?2w#boJ??sz*R2qƞ5"{Jc?U] k-zјgDKh'|#&FY3?. ºc)y6c?ʬo?IQWnh\ŠiDj7ƨ>hJJ{/e6K[ }½pCm?~~?C̞6j?NeK;G?vџ>?'EmOݞQ_'Z&Vy aG\џgO7~pw!nX#gec v,n H x vDas~=ߖn^8Ȧԛu?G<,}z9ⷛM`Է%޷WGAC@[E?p2heY"]<}3Zml?c?Kja ح oUٳR?d/3gRTܯށg_jxBYb+l_~OH ?搮Jii4)iO?K? dYДk2O841ĜVl&T?wSjM^?5rfBqlzyhS9!r÷ 8I?xb?܅SjW.Nld'u1>-INo4q?g:Ȩ* Wa?9+RE>\@?MC?n`a<nY [0vPtAy>mBK?Bdl5flcW7MQEl%̷cX?f:I`o`<[֌r ?lFWBQ5IhV%Q1Fc7G]ؔc}B'C|?ܲ&MJVpqڛW?逥d0t H_?rlG{?Wm}ܹk?edd$S?;lP( S^=^Jw?⥼B{?UI??CCC/K`YoK zB u|o#iVkۖ~_mEV$zvBhR܊R?f͌bD Wǁcے?bob#ey͛__SIB:uc,e8xDEΎS?9]uS0S &tl\-Δ?nu@tyu6V@kAl uceVS <Zӕ??0TT?.רWxCݷ_H,~E?kKl9i?ʔ:{.aF!ޤmJ…O|w||tjj?{? RNN _R?zܡJ:¢?=Cxe?:: Ϡ,o֋B/%EF}x&k6VCpMdK_̙3XkX?IV ÌC|r?9X|v/??=TQzSpҥMhm |c1xQ8ѣ^&6>ņǛk׮uo#i߉7ڞ^q Fm\$jEn8%K۠T8o7܋WVIԕk##zRn??Tۡ{Z+?O \1p?q'У D ) %|??ԓ@56;$Tl{w⣣}L:drAJ\[h#TKđnKJ(lhM?K?CC??55H{:H?Xj`J`(?H,x.֚sM圂?Cm;T?33~ۺęj?*bFq`-h ]MU0TVbuET@nT?If'_tu??Υ?ߒMG6ZB욡ki?R`,:?T ӦH/P_ H?$r]`*X?% ?fgY<۝;w?(E|όj]ģkt̹yΙ1=ߍFIlGV 6F?n?0NvX?ۦ?2Z`FƴCTs#nZ7iL\[ԃGI`{z30p-޻t]ȮEoZl?b"bw5O2kRP?|S:G??_BStRYK乹kˢb< W8ɭ[vk?V0w'ϟ?棛{?SvXJ^H?ֽ@'`o}ƳgmQ?4t݊iE@q\]i6uw?=N? ۩Eyڃ45=W>wLa-yFK^-nݸ;Ɵ{0c剅۷fgg_vr?Ar?8"|@}`ZF;ҁvb`0h'kcL|Y$3]-tfh֡Y?Kuۖ?/?yiho6#?[q O V8?Q?& 誂rߌװs®?k(?QT7u?d[WCev[crAni<:?Ǐ]_?k 7vT6?4z??BX?E?i f+z#6bQ:ߨL_?QK==;Z Uh.jCeKbt+ [kEVhV,+yBzB^Mb跸?u~4w}kW~?е%D R9?n∺A VǥtAnZxԋsצOO]? ^ uTRY]]?2l^P7aK_;m܈uQ|b-tsxӧOYgϞm۶?LԆqr #Dr?ťVWWZFwo>? z7MYD؟g(C0?C??qym(7`\[ɉR"]s -}bc]*UJkXDF}0e,?w7?S'y?? xCoin wFjҚ k𦿧SuQ7_vSqCq]Ԇ`bK_Ũ5rRp:ްD TFݏ,]8wZk(%li00? +C?*ښuAj? 6pNKYx :? ??WyuF5@N9xOIZG^yRoxUeAg3jXaZOOl?+ٖC//=?SPw CH<=8ș.oUDb恋URا??2?,tڕ?~wOЕahKǾ5mz??i{TI0C~RDYH;ClӾ|~n~&D}J7"G TŸCyɟz%YcP ,gȌ)L0?nП=svBŒ! нpԉM*OgD}և6*CY2p8V?ZS?ktc??8ѹOݣu;|?lc0V)Bhz;ic?M[^^^gю?~GoZ;w_o{[?Ip4k׮U0*#ܸqCtX W~sqFdxq?lؐE%Rrug?p~??I?KfeV?L??y &˜$YNCp+W|F?hjIy, x>K7?O ē'O@SNmhUiPzرZ-FGdjVGSpBWE WZG~uj ]H?oyp@SӧOyl΃.>>5|۷?@`? ?̙3Pa|?q̊NJDZ?Kt^TPϲm{g1?84WUk=%b6;׮_q㋇ ?Z,cNիl8tڍ,Z?v[kQTJVi?L?Ve4<%N?BAK7b?|x{s6[)-?e~& Lf]?HB ATށšW. {?‰ Bsbq2-i 0-h1f4ۘ15ktLs,'”x7‡;2\0wffnZ]>p|NV|]kտg?p-F6\ bGm-7~.xl\ ?meP=hAs6lZ xm ?o?d^q?޺;ٺ @;1l7F[kWĨ?1h_ǟHs ?[zcjkχ5WfxAkt ?MŸV2G|ܴG-{w}{ aBZO6b_5#fZl ޛjMg&Ψk ?53o:#s?c߂ûQw?&[]\stw>_i]/^l?|k?t$/?޶j5P`i}Fy@nJs??B}*|Z5Aʨtah?__ Cxb|տ\fYL?M!Ju?~TgN5HLdq@CCxˊ/DU╖KT2]jU%?΂&Y?+r?AVH?׃%ލK%?\*W0RPYTĠbW%̂?E2??- i$iP%T :ʜ8Ľ R?XfQeƼbA ?>/"_e«tr/ƺaLF T* e|#uIN _ <!0G^3Fqp5y'r??uEp?00d20`bbjʺnYy206V3ڍ݁eB"6ȨhˬB&]JUk@ `Z}3w-aҪ=k9.A|=E?|{KAjA?|`L{3|ٸ9Ó6<?KOTyx{1<۳í?x3?p9$A%i{?Տ ϊ?????LUgr?jRʥQ[~pdƮj N?kUOO)5,TJj>=]a|:&wy+?[`^V+EYu`U.5P'iיwYלtZYzIԉkMKzq~ѣG7ox< ~t:7]{ } )̦On0oAlOd+bྒྷi;x?}}观yL? ;?r?)2iAeQWiQD)³g{&?F?[r%eYɪe)roꀟV? ?iā!&N{J\r]{Z:?:sgHŪ?2d) U֩SnY?rn{UusnEurJL84 eեdCE`UV#g3fa?IJשDCq?/n\mS19LD?tul&2q؍|GT=y&bl?7oHw a39=p?խgNѥA(h ?fEA\-ȅQH#&q?c[gYOS,t?_ޫ?_(?"ɶӢI]}օ .?R?nE ʺ8D݇P|~2?S?ϕ5PpI=ՙQyϘClCc2}%:4l`N{Vy?F=gqf/?/g|v"k>8Y `B?TpEZ~)ڰdvcԥaQİ$qړv ٩۬?zy~ϟ?oZ?[EO)f $^~}+5~xME?6۷ls~1G??fo_:Zh޼y3=~+AIvϼ-{~~+ΊL&2UY]dx??ZLhmL]5vͱu^`Ut ?\ E%/`U*H!1a.E E\ԅkTs>W?[IJ9M2>_+ DNufׅ$iK{i`?b:i䥑3?[N p4 ,,Zv?83ue+ܞed3Ij"BX?S??C;?0C?6K7 |\ hl%NJXRZRXw)mw0Ld?pP՟?׈i<#Y`t MQ$~AtLж(o] Ka?E} 9]ۚ:c'?ug ǿ/?n֊>QJl1:2fmF@@W?;CέfH+b=+ uuu6%I':m7?judv#ou?k-p?xrÖ69_53I>9l?n5 nr-!Qo'46gmNHva_?`ďU?̅{{{*}?Ḿ~>|wZo?!E~?R A7ߩ|vvvn^*?/w޳g˒<"?T$IPdQUuE|C뙥Ml^<ۜ~6B;84̿(VN0pU.օ?udPUuo. 7TZKe/]oj?WҾb9qW mf?V*~RƷn M&Kn]B* Tn10?Gg??Pth)~ ?6M v fm?uJ%a# B?4_ ,ŷ֞v6eA´fړg=c52 s3i F<Íԗ*:?ߔF?zXLƆ51=j꼯ȸChWVpk˾gڌ*?jơ84? }`vk?1@ëqhGG?p@?PS,~h0ۛ.[[Y|B?p^?Hi%6?s~ ?dr} ֭[y$p]\c~s?o޽{ƍJ>?XJ9|ѰHb??rֽBhO}G}{C.a]$0/>yfW5? ??g}f,?.*yK`LYӲH ]_*?z1Nk;ݱ,M?<Ӻ䙓eNuyhSus| E{Pt]yu??cX?Zw%VH/KN?@4(?~Ss?4nr??L??W?m?Pg`-h<NX 2dGStH0wKm=ga=hW }^{}Y@:^!QM?2?]? d`e ?rBLѨZb3bTeV ]}I8 \i?[ˑ<lܯ. ?q S 7еDKհEhMg h?cBݣx9n>4Ohki?0@? W},m`A[޹so޼J? 5~ 5޻wF+ݿٯAI8|n{1 _S: W^-ŋu 'O`?X ^O]}"?ݻp/[?i}?x"Oj!8ZfiY?3Q$f(?i:umrly[JephV[ƵH OG 1?C#M釚c|SEM+T"n ?aLU?- ?CȂ2yPyTb9YcF' O̭_s[H@k2,JC`S^z~ ?`ebWv{OsK,[$\?%QCg*V?SɩMIURW1,}s^ҶM5ӗ?&m?iSOx#zu௪Daym CaU yXM׻A(XIAPGZ ?s?LYߐ&rl* tßogh>|{?H?nx .\tBK.\ō V?s?w%+pBE .TL뫤u^ 433gHͣG6sp? /?F~ ]ߺu FJee}ȼl?y;vzJ/u}ᤆ}]1 'O\[W7u|*xG?;*MSKߴv~<LALu*?R)ϙPGMk0OOBWIyVK^Qfe ?eVdqU]Ektv O?"k8?C?I aLBh-?,ӠTx[DR w"I׀qEh??|؀c?nmۙ lݘ M;h?W*H?bc2?]q5??b?z07u?MAqgt'FB X3`%zͪgDs ؠT8JRmN{T V^c܅?s:ٝlc?u|x0:ܮͫw4g?:?~?nv_oww6 ё+CMMA}@7;8*h}`L?hCc?6i?hM{?ojƝ_ ξ$WL-l gϞ}?٠k_>|?߿Ưx߷yoφaPK?|ΆRͣϟgeծ(HN%OS.9Kyr?D"X  ۸Z]'E?3?b{IdS.=\EiXzm06[Q_@rXs#hMr59{ ʸLVCWYPW&'`|Z˜O?8a|ҀqZh'~c:lmV#epp/ЦgqK uHb'=":j?`Z]fFd{F§DGqiԂզ_[WSZ,L{ Klh?[N۳sXh8V:>B?c?=q oiikZ W0s! WqiO8_ꧭwݻw 68 p7of=_z[. ?@q>HHv2pۑmN}8S?,=V-XJNN[uan?M> ʣ|d!d?Vƕp ffǵ1t{=龬ódq?ޗGSH?k - Y@nh oZ4Jk8?!)|~6?dqM?U??v?oam>`Ii2%fLƬ4vy{: Md`?n ςO=I,p-7K؁-pu4@}bB҈B3j# LJ:LNfVxf:Ih[ tF?=H]KN?eZtpt<蚊GtW"GK\= x``$Iφ?Bg?tmϔ]FbGoCԑN-uʌi\et1A LI(?>0o Iax<gkֶd}20+?>OND03`LЖZH >zt!2Dzl '6cc: Y?LSА'ugҹԳ6t>?Ÿׅ>?VgjpAMVvi.zwNO?ܮLsr?sӍօ. 4h# q{mc Yy(lFgϞ麾^ADŋ>|]EC\|VhKW7Z?Ļw Jamc_s)?fuGI֤9YsA2OZ Vi aU&«roU@rYUi??OVU#~ o߾?eYbW^ѷP}?>xٳgyn??~RBsWWeRWIeUԩh*?el m IL:dRu_Ƕ:)slٱa?GY[GI?{~u}qس?ⶦUMXaF?[Q[DEU%Jy UY)rVw󨭀jsdpJ P]gQ-qYr0LC!? r?S ?nI cH؅!ی?IؤpQ/`?dF??v?A"'G \#L<}j$=#tؖ Oq u?(2nᾀ?ծqۇ$b?v: C[ qM:1־z r p{?$% ֞+_CXp}康jb=@jG[]`?'h;}ʻ%܎z?pRwh`SLe1p.Mn~ owڇx?PQ6ƞ_n&]?JyuxXOmuvΥϑU_]$=z^*gl?^ <#/?ޛE.TJ2Dzkލ}mՏϗOWt?߿ŷx?`WӴ;w}W_?g`kM/?s|5?{ǰM6~Fs vU«EVyā?ֵ(D̥C-?7Pt%Mv?"?DTh%?t_Rt_R"}Bm?@oV%qT<}xU[ YUHiXpRp?< lgؤJQɫ??XqxS h Enƽ\Pq%?P8;).bل%<>ͤL |= ?DI?a{pJIAFvwG?@: $ G?8D@=Pյ׫z߾՘pF@H`??fƚIrЫS{}Tw} vl)&1E[c=CYߖ!?p}x?=[WO窑Gihӑ\*pܛyZjdkE,0z_Xh?K;"?Oޠı)e[I U]>hp ED`uv?ӱHgr|Mb ̺,&G'eS~Ԣ_1-RZ'N;\OnxŽ[?&P,@? v X|ƒX؂zX?`gq&'?ZʴNi q O`?;9x$1 Na]H?0yEyޡc1^]@i;`sC8 2ceOz 1 (I?N??Ay9RxwE)?~|~cܾ}M<|жC,o޼ݻ~ׯ_cϱ_^~???(>::?<~֭[?(޽c{??K?$.?:K?Tɺηu??DC :bklf?ŦuBoVfEրwS` lwvmjКˁ8^t)GCym[bSLbG'qS0S@Zx?(h[v}iqA=m;==i$?d@YtmZ^Vv?Qq#mu<??Ŷ82s;?5d{? X*O;<}@~d b,ެpK\AۡWdU* <="FIV"'ZIGN5NPvϑ*j',#LIV(.RPLئmm˜)K+) l2M?L?jƎ' F@t?DH| L?p?A5 -Z^3#"p=?:vš̆sϬB?RWsm?8SGM%?G^jT?@a^T}U0xS)DZBYہlA`tYWܸ ?U}*=\_P?jh9Q9?+ \)頞WCiޗ{ ;fMn]C 7ܸ +,]cCOIsu{K3 ŋsoMTM\Ȳ2ŏ?~TWh]E ZETWvUb_:/?]S_RYa Gy+kry)lwUetD3$?6iɲ>oMr5??IU|O=Eyq(ڦu񱍎uplö kHx5&k i?>4@x,9L?m P Eup܇gsfFmpwn;WsvN@&m?v#?[?}b p;+R28q$aD$ZNtdP4Һ? HN̐E`NdxvVihٲon|]sTJv?pM#/zl/ -\"ٳ?ibՁG?.m?tgQFN9?:l20qNauS Y2v9FWK a׎?pp݌PB|; ?#Hq۱r?WL?H<~=?;l `*)Wf7 $|fԕSdbrZa?idU ~xYefJ6bZ82P3 v O0Cԩv[DVqD?ku,??[?`o N&0[k)šs=CqM90UD0* &ҥG?y{G>- ۧؕg?A3<-ƊZhFDzGGGL9D|eh͖c i\dn?U;gP+4+?n {0* x,m';/36erLby&D8SXzdBv?6(h !V27r`j~&v_#X;Sf(cAcq=b?zos]tB%tǎE?N ̀c ?. qq MT~Kcmist4_4}w9x<^^~lY?~u_xq޵e?ZO?|rr_?|?_NdiS`BBG }v\ejԹս}!$? ?qH+l#|mο?qv|7!2.d?Xȶm]?+?9oK ??ҷ^ēi I1/}uזL}?qWh }˻.۷뾸K̾IץE+nfߐI(ZC{B8uET[|<Ԍmf%Z*JU3tmfF4y?BB8?uH&i?wRHkI+T"H>*hZs??"< %?A_`lKWYCY?C?asjmהYs`yC,Hf{`14K"{%$ő d i1?r ]LEm?6{ mT??;k *1?EGEw}8{_xqO~) |K煻Gix=—?nvO9'sSmSm `?+9r"gioW=\v9X5GB ?[Z1^+hg1…sxntuPf< ?bdBYacS so 4䃫 0ˡmGEc%ō'm\XOL`km'j9,[0왋@Su@2Z݀A?k8āe5qW3*x&v1\-Xkgc! XA?n`-elkC ^Oׯ_߹sٳg߻jpt:}LjT{?d>|Z?}w?Op j??Deobf?n*^\ZySIp.??V)RD<5h-.{`}yuY?d_}}wj_]tվ)Ye? Bp5 ]?i[2(?صv[К5 yRKʴ(" t+i)ĉ%gӶHgD.ԯy[ ,H-?9DaRr,?x"P5+jh-+nOR,͠ slbgr7U??%|!<,] ? aM?9 ?J?JBNc-$V's?vh hyĉ'l[&Qlyģ[Hw'M}+v-r4`/gzmc[o]߀?;WʴHhc?؋cmtmQ]߮foֶqNefGld/h |b/˱kp5z_nkW_ ~y?K..nĀxFitQ??)?W]f?0.\qb 'lG"Z*UuG??g?7?h?i|eA׏=ڳϟ w#4p84 NC/WW?f-Z\٬X EX?xsג1cM$iSUMܞhs[tW? ` cT?HC[:=? DWO9?-Ŷ`cP_:mLV1 ? | +ޖJ^a)!~T5*?[p Fdz??)DQ_0jφ-? VDm؝vHm%VcC"f+T-i_ LuRƺ2JS[O&a{b)??aMKq`\᧑K ?yE?+pūW~hQ׷nR3<~2Q߽{?׿aӧFn%~܌?EVEysd[?O6hq?oe,EWzz 3]Gֶu]sJHL?u!u#CTQOn K13cۜ2? n5?r<n}9YccѶmCg; oonkZWt]f ?3X?^?)qh•~] J?]`ThY?weTm›xGnl,6 Yv{?x?sggi af?HQ*2t#^pL,a0N?@I?]:t{?Jcː`*X&<_RAkL "=X0 - Xԃ?tYi`??6#a)N+iFBy씉"7o%Z#(?E`EP?YGYj^?9մɐf?ЁF XI[tIK Z2wgeВN㖆@:?i܈5FK?_v\Uƺ󎠵ZMEVbVUӓ*EZn?j`V{k+Io]BJ?"?k0G!"'?Ձ>CBBL~Q ,}348GеNmul+S=}s 5??ӿ?]޾}?o>~sU?oܸqÇߐ x{ٳkCE[n[\{5?D}Ν{ݽ{?}x??O>|pU_O%%y$?U^UEEiIAYPJoq".H?޶U(MrӺ KT 00AC? tԪI{R?vol?f!gYE?{G[8s`9 bͺ ?fv ADYE*YeIEc<-R=OPIKe?Ґ QN<ȟ?[?%xPK}}GR_7Sn߾?E`usM,y"+Akd?O4lS^iIܲLX~E]늜?Yj]e޶iEj4ζlǎ~yf,VbQXO(Rd' e:q?#?nsy`_ۂOqڗۋYp>^|`O}o ^qGM eF?S?\LZ Кk\e`1ۛs@{ c9]M`ۂL\8VYFˎ|O@?vlmd:wj~cJ<[r}SX7 S48?ܢ??ŵm(6/jmooܺukkk?y>|o߹s?{?|`V4EQ`/y߯?ٗ xߌn~?rAsBYEB?mH3u[ ?ń֎ ץ`]?$y?L@Z?suIOxr^{FUGe ZYlCi`d?vZe eZyiQ&uJ̏bĆˌs~혚Y ??"o}U?VގYrF=lBeāo#㊄Fk`Q3?ICHkS <0CmR??Χ][cW3.;".^?̌;K ?;z?_BQ}O}kr Z jn?tZJX[ZpL<-qR?0j/G?Mued}??C@YK J??F{¤)3t?~37[A~.8L 8?j51jZticU7n_Gb]TSש1ckhcNݶCpR@W-č)Zȷ[}O ? ]+_&9Y#$#y -"&LjHup8MaYvc7z@]?//(xbɱosƛ:?~?u6d@˻DݔsVqYӪHrYg,?K;V _seM|XWyq/F$۰b#6Mu<%Ze?d???*`]喻9Pfg -6??u rikȖ˥_m*aȄs? ?d`?L/SژRRs jg)݅r(?.O@3w vx}Jla`DE?BR?,# WL?cA!hS[W]4 B#?Gud?g{-B?t3BڑAg@ge y?-\Ca,g9CDG/KMim=;_ i^? \ B]R:I;Z?mRZQMXU:?F|;j$hOrm VWzvFFWk{ fN:kQ ?:u F[@N ꤍX~DϱM\,=GJD = _aPɜ081>^ JE*bRrq __On޽=zt۷oc7nܸ{y;ʞn?x>ċӧ?uA <߼ys֭f7od??S^?rě,)sq"ZQkx3@k]Sp7K?EQÝjYZ\MnĺU?jj3Cu?lb$?\O$uU ?uKb8n*r>]9`yVx&Mu&‡Q!aBiu)A°e,|.e ! p.(5???Hc!d? ?rq!X =3Zj`*Y.]>:WzʜB>Hʼ?G+9@ I]eKz> Z9\??{/ăձ hcճC}NG> b-2ۛoSFYwn޼?5wHj!_^ޯ/sg gϞ}wc7?yTT( ] ^򘦈3ZSS,}yK+ETW~oy—y%Ɇ NkuᮺDM?:Pn Ve^UzU`e?qą ?LRk? rL?qduV?Axpd%8e{tֶn˷?s`%` X6!$ dFe3M?r?~<EqN&4hh®9A?؎#;OJʘ 8 i5n $зf}B؜y؎E&"?FNm=ٴx9o>r?X塓ɩW֑?񌘸xN"R$2ϠČK`TL6q=s8#8mz^+fL?~zFi?Pjj[qT\?y,@/̻⤭jf2[Ҥ!M[*bR``ظVYY[*?X[`@ZruL?icqYrL?ߕyH+[wJ p?,Z s،}lc!t$Ap.?smiڄyE"bGYϭ'GGwzrWrab|,E`\۞W(?ίX-T\żϊZMe?&XS޿cg+h퇷?p@⫆ ؘeOOOh\|K09?w{lW@]^|}{F_"|!\r||C7??n~? B:4sJE Z?QS})X:?{ n6dSUWsR^A?5*?“ n ? :*3ʝrt?A?5?h}\/KkKКin?IR#O??R?xÄANS3l̈́Akwycf in]nU@,%6D F?n\p]G~X eF[lȊC;z0\Sk1N?5uS_Ήz?V/}xP{b$N| b&l#$I}0AZ?*YE'?؆??]g??vW${?pLPV.4%mm%u]G?d&?8 3Bȳ6?*s)tؔf¼ݭh=k.MaRZcxmufݡ 62.fpx-V?ה?hCfYK|vݿbB@?\R;aEuT1.결RE[?Ċ<}GrTy+3I7LPL?s6e&;٤fW𓊞Tl\"?`ڪՙw~I?6?q7rhYj噕^ϤJH?IfP WHu_qcy?P /H 4@k0^P4őE#wZ?&'Q᳢YR˩uH&U-p2_U\?q6@LM) -??P};\.BSj]g??cD~ϔb!P/-G?5 ?`^[V?OL l3#UP`>l/f?\]+i>zbP<ܗ[l l_>wZ\W?ľA=4&OfYa>?*c\ҐљLk(dzQ?ra2?,TW9\[x?n.N jp}|G?'? HXwBbyK?O@bv?8ue1v &GZƘksFklRFr?Evvvvڵׯo^a]ti뷟~͛7_ǹwիWaݺagg~:q!!!@H@ Ͳ/rnwݷ{U_m+Ȟ I?a؝rduWUݒ?}ƍׯ?ou}-۶?ݟb_Em|Kd>x_оKݻ" ! Efi\$I'>3zԦu(Kwa*ܫ?YY:guWYemlkD*GEbJweM? zge<(sh9(8+sEerB댻rni~D  pGi?bPt ];<&yF>8m&P c8zL2yBN?'M\N?BZ]sЍY| {?/OlǍủn8?Wc]qpu`Ci`H*&[z? {v0fxZ8XŶD`+?w3&:ԑ9?{ Rb{1 Di?k+NSumtIo2ST a LZÖDMOAçTZYg1=Qi=mThU&qg1/m `-B?kGO'ʸ%*???`6=EP1aC6[E]772C@Io?Y`TDEhw \c"yK)z{ڡ<}r=Kwޯ=A?ߡF^^z07i^vmi?n޼4P˗f~?,D0M}r?D?<Kmkᬵ_um[Nbr qߒ& \Q&yM_\MM?lwebr?+$Nl*p8n gw54-{>tQvɝRX < G| +"{>gH9I?gl?v$J a 隣 ?;MeA g2+evY ZOU^-ϧ~H&?;oiղpEJ?v ^?E !['M{4lCڈ1v?VRJxV?sאoNH 4\mTKm:rF ҄خЩ|6?CU}? , @ ?ˣִiSN L&uR<@hqk)wMo>[X Ve}SE&ommdizk+RKlDuz!}?s[ؐϚE{6|Tcx?S MPdJp ??._ѡ@W^A\GGGO~?޹s?W<}1ǰB~ݻwqs5~5?I 5q?]ڡ?U".EIBym!ve?HZR*bgW'i@/I`b*8MFޖI]h W}n?`?j?!s?r iԫ?M??ZW?gP4H?Ү̲ q ̗!v꽖?@~}v{uSDkfBΔEv9RЋZ4i ̌ XJ\KV=o@kیU9UnjFq䤱 ёQRU3n?M+Ʈ߈ȉ}}2sS`v@}yNCu]"y˔-ogl&[ѥp?]vA|Q?6%6Ξ` :JShD?^?Ѻ?!܂P(\mȽ^W=揄~qEXC>YTd)mR4-l`%D]KY@ saYG>kx? cQʺBj?dMu`*CSF2\?=C!lgtT???tmVαYy^zqK? ?~/LܭVKݺ?w)`,^3F^$Q Lҁ ? 4N[j@>綼qG?ޤJ3??e(ƖV΂--pZ+?|E?iG?_``ǹBzh4fg޽ǻ^_?o ?Y]L FuY쪁9 <הB[Y[?8oГ2n*v ?顣ol]wg?zGw-C \ rw'}C1}鮡ZzShdz?-Wt2?hv܃e\?T?hHqMwuZWgJNA9W4p10_3$QT\p? UXC=Uω;?uEhSJa?Bwlvt:yWcF`ےcc8E<4???*”??\ґWzoS>?O>|ٳ_O~| ?Gӧ??g^]eTbz$G?cTi9 ?ȩ 7%i #X˨_fŋKɌ\!JB=E>I9Q_?AABS`c@?n,E K<7?:[?wWah f37ط$ vXrO'fW?? ^*Pn.@h"\ѯ~7qs&ݜK ?tq0HZ~Bu;ք1/`c jl2Z`W| #E8pX̷%_ElUԭ̝oS?ĔNJt)v?׶t$~~}E?}!D`իW?^x/l֧OF^x|']?>$I? ڔYS?!I[$k@mŒngzzÒ۞mShk3 ?{oM?`n˴)A`nemCw B> ? *~~ ?iYX?tʸEVWP'Pt< 4hai*?  |?*iS*F 䎳ԁS?NqM?uXH#{?|?oicTxvC^; \T?:@P:IA:zcҲsfhY`eC?4BτYz@xFkjеmM ?4#O)Vp F, ifJ3[yڑ?HU] Riu1 H,.h8?go˯>˖CRr|C5h o˫38\iTo.i| cv"G=Rl@@eso0;VGL ȼW??xB@!CBB> ^lnjWu=]@?%p@dF.wtԪ>Su[j|hfyO/o. ZYOeXKx_*0?rW򙆽{G :ųH'tjBڝ<`+MOlOzx }dL?aLO8?Cvm׾g]=zooݻwݬ?puÇ[|ٳg{z<k?=,3кLO*?ݕ KncFW۰{Uo[vM6mږ:lsEQ[@uSyu?uZw8r_к Pq Zgs7N&?jH ?eV*"󐧀vuT0|挤? _e"kO?xҮ8C??4qpeWx?aPk?hqDQ+,"?sLV"B+ $A>i'\?du͔:%%y@[E?BLKySnj?hzcrU-zu?#'$ԃbOLb Z>?egN 3;%r&?r`ɾP[\ͷUtnKgŐSASt) | Bzq TtڗG?Z6-2kYJS?@Y""R?KCA?]G`g bGF`p N?yeTJ|KB];"Kd($L?b?&VᰜLbۈ ?js _Q `G?%f?C*ʁ m+r!e?C02fH |oĮZo+D[&Q'?MIpNӾt=MqE?qWgGЩ:?:>İcȈ$L;uwQɠLNc ?l9xD FX ?Qv? Ww* d?hsQWbѮ~G2:FSSa`)`!e|㥉PLdܞ?δ@?D_IC[s]k94?Oq?%qDgq K` -yh"$j쿢]۵۾|9ۻwx?>?]?{ ۃ??|{{ۛ/^)wm׾?E?ϊ,.ˤ2O.b[UYIQDY?k^f?[CޮS(?`{пMzͮ՚U\ldW_]5oTi+?m7i[㶂y 'g?]E Fg;hnJ$iYF@rSm%8V1<_WIx,pKac7Y`iq?0 x3?x3g+;`6n?,ydfn?YA?te7VZ#E`yd?ޥmuǣc ==I-J Ƴ$?7DjQھkHs N_ D=Ф<7tm.bwBoU'?X C].>R&Qr?l/f$xJszƆ42>]u钣~~ui}$yuݳ?F٣Gx?U횦?O|mpuZl]+WWUTbW)7sTSqG= -pKϚ'?bN?+?Yr?oW~q{^uW(A{Vl=ݢ\7 T ? l:D@ mUVˏ __AS~f:jU,Z-C خhbtaB0@4M}?xqpj?V?ZIu\ tA???bZNJwĐgW',e ܇u?b 6]#"?,?!<Љ֑?̌Hecc ,v0R>+ CF`I?Cs_YWkI} }AN_Ma Kxtiƀ(8Jti b:wݶ^u ?ڼR?bPF??Yϔ? g Cs3=_ҹ) —Wm[ W4NvnNC?z$ŅAйg*܃{k9yyKzujhMQWPggi *#\%>?k@ ˑ?Bn:?h^h}Z?ݻw߿uwmIײ/_~޽{_C?߾}?{|}?N?|}]BѠh $}S]y] i?1]]FUpf˾!ee][,ݵlVW d v 9Wuqup^*WuWbwY[ڮR?B[:?l½udu:Ѥb?*j`V?\Z#]5>"FZ|*gEF?E̱) ?8e?LC^%o@0; ;puxn$4s/[AK?2ܯd:I#b&3`čVY@7d`)?p}#jih?7 -4DĠu]r3gwτ硵ґ %lL?ytc?@XЎZ]>_^l[*÷G?pӮry?KT&iʤ2~xuYp5k"9#o/?3mHbv&?dxzꬃ?erQ ?Z{zȽAKˑ?wV:ö 'H;˩K eḃmI?㎊?QƤ}i}F? G_]mfS@q}>MW~~WtZ?oVzI~rAS05 ?9ҁKTVGvnGʒ mp(ݮd}Y?\mȼ!;dJ?18Vm?}2@چWF;=[ -%vCmgF^wڎ#;f$n9mT߳M|?q孎Uy\-5O?!a[ ?K"AfoF> ?L圮|z'?W?Tm @ טg] ?Z~j΁gbW TΙ]c`kl%0& fs0 e 2glo@݅SV@p^"h md IjyVi"^cZ3Wc$y&k,3)UAe H*[50KG4u5??a(OSh:PHWuDSeUZeʲʐy0l?Ev|=޾}?̗elkǻwGC~QzxhmǞCh$Ja־m?g?Pn[c?Ʈ0Tԛ?0x'鰟d`F?StӴm,Ƴvu5??ra氯}5{1B{Z?I%ߌq?na փ?ֱ r{ W}Ohj??d3Z?l?C3 dn8 nG#t p:kµMwf[* Gx𰦫:Z`!3BԞ}WGF-JW]RدṪmkF p?ǒfymɶ#Z&??g(n????8B8hVh?TIH[?-7\-/ "?{%\ZK?֨Xϔpe a] uAqXC&]ibxHdJ13dQx`- Q1 -$x3m^"VNa/U |939a9jf$X?J|Q.%eKm`J2[XW6ź)4d`*Pո ?R?dZB?SQ\ ulWvx͒ o? VV]nTrc#Sz6}꟢x?/^<͛7 SRxqwwwӼ~?{xϿmr[.acV|\~r6?c>x?f__au?ۛ/?;6_Ǜvvn_1?=f_?~lz^oדz]?~=;lP|r]Mqݯ678?'xvv9IqG2׋h9?Xej]ݬr^\o?A ? SٯЦ.P?X,JTP})DDpA_?"}?z6ijڦiNZ-(8i3Uiڴ^?x?k'{AY7YzEQ\u҃S{[ר^Jmu]JSq;ښ[:Ndngc}mR\Ze3{vyUm{j]U?KpZ"ya)?Ub6?hUSV[>KRpNE@j|>G'f[TJ|ysss%w>|8??{_MGGG8.` KFӂH(G7VF:[D %շj<~ Z(%Ũ/Q$?I~-ޕѺ }݆iXZDH}?z{0صnnc-=(p I0]KL(&`|^]x?Hr ?Iy߯}Ovoko`b?x=hiXon5$ԟpKR?9ٳg5jTAA Re?--?DL&SvvvZZ… OeZkFcaaY?33Ϟ=R]5gkmmMu={Ȧ-[$Օ@ BBggggv?cF^^?{ё??wfze &J˗/qƷo?'L &XMRq Tﵴ{x^x׾n-**:Ӎ_|?޽{?uj ?k.Z~d)?ʼN?̙3uFFƅ Z#UdCeX$_o$ݻ6=ztro,Xpҥ^?v^Μ9sС: >|/^ ɷ?~ܹ6l"Rg^^Vsz͑rM$#@]G!8|?>|y?rNϟ??qf|ynWWW_vM?~ ;v l?ȢEa޼yzu޽ۻw{?;ˏ]|wر͛7߿{ߑB{kҤI+3g ?ҝ;wo}˖-riʔ);v?((8r7m?zhˋ|I\ݺu/o%۷nj}ϟ sn\9rdNNΊ>]ѣGZ^/YDn}Μtڰaf??)Bz555NS . Btʕ۶m_PEܵkWFFF^z51ӧK?y?bii?ĺuz ~`gZPӦM۷ohKrܽ{JKK[j.>|_TT#?%%p?h[իWOU^=zǂZ˦~F~?C$Av[:Ge?F?roDIH%a8VE???!;P1PK1TBǑIδ絮=Mb|^S\RR P?h(>>]v)Νڵk۶m)`i;СCZ??~t'O?RRR ~4 ftRsǵkEϞ=srr윜F?K )UTT@BJ'JI $AКd?R6? wanݚv*@ڴi +V?2W^RRQ?" ]S(VZߗ-[s?000<<|РA?22McǎDTgj ׯ.]?azC(Ҟ˛1\pC_~ 좢4 J3??2?NzU֮]K]v߾}kͲL?f~&J!!!?>eܐVE?Sb߿?G{'?;KbAk%CFg {hgϞ͛776ZxϏŅK ;^zEsppشiuhnnn{ơÇKqi :?9RhMMF2h zBt ?o[{.#GՁ޽3[a?Vkhт8emx n$ATNNN?Ssl2U?yqtȑ?J?< c%ѺlT!m :?>>)'Oi Wll,+R#w1?z͔RĢQ,Y?俹h?))Q ,_Gõf5CIpf?--M"Gk? ?]Ν;/ӤI?]:uhIIIH;n??ZS)SLa?cRf?pUWi_ֶʕ+U|&B)3K?3dT1?.^Z<¹P Zw޽_~Lm5jٲ͛řjoo/?m?)PB?pΝ*??1..N"Z7?H?b_XXH] TX2u: 5Buuպuk|P"H@F"kК Cn?^?Hš??I޽j!ZOZZZuWܦMZ _~sTSⲳZY$0i?;v?YW޹s'~Smv+oP]Em:?HjѺhѢſ4jҤɰaToՊ0zh֬Y76j@ɇ '3FaXwZ?}t}VEdNHHhJIIQ~cxx8߈:ʝ2$++b 1sL1gΜ,s^z5i֩S c؀(N?VUUj2bElӈ#?;tЪU+Rh޽ݻw' $Q||< 6l~X%r^߿/m۶5kO7Zb=<k<&?Um>ڮGDjTZSv?ڠ?rm\zBkGJJJb nĀ>UVIbӦM?i[[l9u _|i~~~|uPhxb?,,?gfD۷|ҥK}||~H?_N.Y5h၇UFHɉ:5INIu릵QI;v?u-FzBkd0$XEK A?⊷EP7;lj@\6~Stt4_2A߿HTTL<۷QIF3]tOOO׹n=ZBwD@5oooBްaäG[j~YxcccTj@U?M?%l6ۃB% ǯ?/7o.?upڵ$ljF_ֹsbnݺcrΨ;a||<~nц?yEEkzUE**OT6<uRiO;?BVN [DYDC*?!;?%AkD?2}R *L? pJ`?˖-􏕙ɷO+qr_~lfSR؆Y?:TGec~"ALK?gʔ)iPUe֬Yd,u*X!?cܽ{W37ofϞP^ ȣiJ%'иڵk֋ ?%i+'W[~ y1OğHDaADIIH>"H- ?$&L߻.?;鞋=x<_fv7sρOQ׽8 RXlBṇ]?U Ϻܚ6hy?qJdR?s?l؀; [lA,V–򧦦 ?>^[]>N0?|sJ˗ 늖^Lp¦M}}|n;||EgΜY`t~?8؊x*>??ø1DѣG~׺G 34~{ Jkq26ٳgn Mrn$ڵk-˚?ƨy?Ao۷ܹsXݻwg+<,}e >_rexxw:p FO'W^EsׯGs;=^v~ы3-+mgϞ'Nyi׭[?b]>իWg|'*b3xc544^?a^~7ݻ͛sBWů㥫"pA2!믿W^Zr;~_~Y|gfsWzP,?{ 7ڠ_T!u?`h?iV[10P?rHYt)'OBP?'&&v?w?vp"Aռf͚ 6@Ee}뭷p>{۷o/z?;w,Yҍ ޽{p. s]|Ǩt1ҺʶmN5oFswܹK/aN~o?44;NcV rwG?w}zǯ](~?o@#b)aLMM Ҡ?v,"9IҺƒ?O? >||p7n`駧hx?p-曑]&LU?xo0?k }'Oy'?iOx^ηsSjJsNaQcXToQRDq\c?a X?m ?q?i3NI?R4m??g=SqTIi'I;I^NlS̶@?ڭfEvV4 D?gLEȴeΖ?S6u~BT%rڞ)RͶRȢvudZɌILhfLmM]+5D7hVɓ& 2fH??cHduV8?jaI5{#GFa3ZpwGM?y\}O\m#oMfڦcw,|6reV޳ ϶\]6v?_1g ?[ ?}_^y2?p^ D dQ?gEKRNJIiAN\堨0ARcJeɰTʥdX 'QLrE?QUɲj^Ց*qL9k'WzVC*kFF5ԪqUø6Z5ja\ bF?2QY#i ,]kIQG?RQXGQB?$~ 'qmUVAJ!h(dMڪB)J +'d\-+CWJqTWW&b544~ȤuCN3|y?h $?n0f2g? =?RCH?Mq^qeZ'mZE?C\x٦_??`/ub,z:KRhE?lwpS݀C mzݵp{?Zz]߿F9qͣǓ˷ޅ&Go]?nu=㈭˺]Mzmne\z>_ϗ~_6r\5?h4y>qz{ FhR?v4y|>vz~DؓMa'0Ufl },]T@HN%>\H c{em}MaA?{ThրF?@i᝶o Љ^?=5NE@FݲD#<V S?]3,0xz^+P\Dzx&ijy ?e~ZL֥0:e~?]rAemy˶y݉u ‹DnWƆǶQ>0wjIK^a_Sj)G(^JI|kS5͗hu?PaRR|?T:O %V/[by4kuj?ˠBFAfHh>rY<\ژ~.&bĕ6MX?ac^>Utvr??̽@]I:1j$O4 JsF- Lp?Es.L R|:u+f?n n׵?yM#OW}A\ЀؕC``?Ҟh7W?0lDliG&̧_}V("Pi"gWbg?p2#O??z?]6?xv}m?/Cܔ?(?џ` `kd Z~*t>h-jo@k:H?ciG/h?`= i2c?yM^Q*d?!7Ed rK~:K52{cןھ42BWs\P7巴u^g,x-??3Wqu=OM.dRiy,[PP?yΆ9S8aR|_g*6YUF^?BD{6$e[2B^6X`@QO`C'3\ٖkqH-ޟ! 'Xw?v sukOCskiƶQm];PO?W?SݒBT=E(Cuf?Cy)T 3r=NP}f^."}-?̾ MȰ3R~n TVu?(i_wㆻW~ aK?/Q[4n BЗ92ݸ]0(9?b?M ?_6]> SE?!` F݌Ww*%p5]?Xhh?垂 x?WMK}ZbЉ[[8dZ.iĸoKy|VCVPҤOv*d?rf??Y\»LфEZ.*,)/Ů1IgK DN3ޗrecA9WzH]qT Z|xd?ٿ[^@f!dID]]XnoB ?y`+V?Ϯ?]r_H ִ?Noh?DkWU~N;hɃ*?0M x>̱4apSEH s○FІԊDԢ'M ?y?u`R6{ԃh???w"Ű_\-j5d NKMU nXo?ZO g?B` }M?~TU)~>Մ @2 bSe7C_?sVns 4?@( oa}j"`;݇@G?y-Z_a8 :Vm]Bq]?4DXcT;rf$6?ƞbFQ??:?}dd܄c C }.$~ĢQ6\,J>eԩ:,_r7͜nﲤp״d6dnBqژr6<3&]C rRAd^ IA?  $:{y?81 OU f;tZncwum3tր? Op4іyO?qM0Qm1Ũz%gtI+鸭`).i_mȽmZ} ~n˶՗r?l?p5Pvo?#zّ#)? x?[`+6l`x ]Yy[?H#Xφ9Qc+Ϊկ ?Zz?e= ӬODzًCTNVMfc~?fom)WQ?KQPKg?᪻˲i{uDVЫQ {jXuVz},PʶVHfY??؊߼` ZܳBn?v/R%I:' eV!wנ7b&^B??{b7ӌ]:P^JO?N XK hktcz?v(Z?ҵ2 ia,kҝrom췸\?_i?M?u?TwF$%S7V |MhCPtMi=,tBCb Mߍ};BD#?vCQ.Eðv7[m`pv;~Ah罱=ia{XKJ!yO"6/J [OYp2?|ҮhZga[*??H}?q΃}q5w:J[HS?En?{+uuٺ.QJ8rheuo@g%?E?v0?bB࣢#?d۵k!q%ON?GWMٍB0款"tg?OD9,vE̝n{fp:},Ct)nZG ]'cPY<\83:LQu1?sZPhǎv]nM C?q8۾3?abv`lI?'tmuq?ه:es?$T/eIyB̄Ϣ|pGoZ^veSⷄϧjͺdi2b?^N:W[k}tQeuO?i0o?ѮϽ?vtM\̄Dᆪgh??t^ +v-X?m [sA=G ԜL)=q#?l#b L?j?N^ ?s6u–N!`lS {Xx&?uu0 f?n,?XKȺ?R[?ݒ5GveoZ??Jԝ]Ut2vjMm%EkXFw?Vjn9~çiܕ۲N MPԯ^a]+M\!xPksTh*QKbl TzPAJ@Q??y?_uvW7~p''C7|)xW۟~g}UHNVR BӠF 5~ (WpS9GGy@ۦlC=R{NeJR???u?aEkYXzq??|?+:QK/H?F iw@q`~?D@UTˎuqhԎM\eY?CиE;;?+jf;ol[yU?Rk1vř iq?P.߹޹ ٔ{H?`AF]*gj2YzO{A{エOgZt}Z6O??dLhempߦu?M/+SG9SP(sb*^_Mb+ʐЫȀ?W+zqu?S\iHSv)j 0UQoVg?Vg7Q`ݱLXn|ӽӟ£Dk?DM:ۜB˭y̯h sVP?6{{"#\ݵUlj} ִ8?T@iVIAD>^:~`RWY:s3G?0ya?zgYiM:@m{~f?<׍?;dtEc mC"?? @?\ӉnKu-x UNBV^W?L?۽*+p!r?{X.z?c_Wj~|eVW0XQ_>Wǒ?ű9gǬ~ֿ|xNUٶbҳ5?jF.e}vi}O1{Ci`aEv$أkZJ2N?5Njyk$Ң)f5kI[A%Ō}y@vKkzr_p+_%dv ո4KDׄ1Pש[-?,-ho\U5|r{9oio՞RVt~w|+̥`^ hml.lss3<) lx ։O4@.rAN6?`Wyso??crCW 5k˨u7Jκ FqN:soB2ȹGBӃ-뤵>p::h[EkݻoA;}sftPtnm+:ucd?MўXΗ/zZUM((c?SܑV;q t`䂩MAfffDei@!D%W?St҉Ynel]i雧we;fhخeo={tqta4 >i??jL>{z?xpv[b⼦uGXFA@:D#lHܛa6?߾sh}+t-Nkw B ɺZ!?GwuzqAZq}cZf|d0bY[zUdgmlWw?N(fWZe(ՠU枏E^9u{g,O?_d =UY" մܢeQ _Bs\o˼?^3qPdq?pr5V/]s\D}اL?妳VIoh]7 Ѻ?ps麃gR1캅jؓ]?Qxp烇?z??~?ͳG7?|?>}qp>{<{pv<[bKYQW~X+6w?ZN{tQ\urҵ͔NiGm:mRɴ^u& ?m7P]KD [{kJE[aDe?8A Ed߼$WV*? w_XZ!"SrRw??Ѻ??T Oe{ U H?lkkY?qટfk?iRW{fK:e`O_'qWca/@5tVMgbY\h!M9V'm??NMoZGhcr2_?Ao V^n5bvutT?5?GtAqJᢢȊYɄ]y?_gyvhwhMTwKkloyː?5P`ŠjM{C?H;rVq e>M+2*.͊Q.S덉zT QEPnXz3)ȢlaPEqL.w;Mb8?LZy? kZKG?(̖6W]g?ru?(cKHyGq?qC> yc!;eCbaݝcvػ3]U\=C /|?~R~?=<*McgFq#HÇlH?x ?r}΃ȡ^QzJxHo1Nv-g[εA&2?0*xfM9gܷ9ޟ\??k3~vV E~|:3?0??5! r Dʕ-m?p(Wȟ};L q^H. l?g{<#ÛiaT W[r[{i?oi6sĻjE? p`[hb #ۖlҲm8ݛD7l)!UF^a DȭԢJB+?,RQ ygMqasPFfa DӊLl?t1d݊]fz'zGnlwjYYR?W?/]]zoxtvyŵ?ig;w_j=89$W< 3?@n< ؐ{K ѭ!mIhR ioyWq#nlܒWУP)Z R˜0XbD FkêB&` M? ”nAךL˗8Iލ(??$RI퉢cOk?Fi!ؒ)I?_ ZnS|] ]]NNN :]W# ׯk1? Y^]cKQRp ] B)f*?ʃ{gLMF"jq2{xhj¶£xM?Xbip`_rE bMٹ۩}EƜI]^54l@Wʌ'4Ms#qok<6qDTH  RI?f6Math]h]#vJ:U(,&cf5z*6PmT?G0rX&M\s\XFq*,}XG ۵7jW}tף''Ks kkW?qiAcrqeasڅOxxz}BsJqyۍ ?K~{k׶||pӠWW?5.k[7jWj7?yqkva;YyE f08]/ \ Ak2|C?bzŽr8p5 R}N?E׼A ?(Byr(U?e"]!dI߇V?lS|.vFV^?IjV`DP?w"HGaa?F?V) WX]@5l!jhiiԢevrᭌ+BgTX?~zvr,tzuAWcwX^n-6D^\}YBa?ªAf&ְ )] )Ih`²?qJ : fҺc?;H؞8T;?KjEWjRʗw)ֱa<P,<ۥrMtcL zLN ^?ql?La_mex<3`.AkiMY;fX7? ??pw}+J]M!O躥©_SOa??qԩC>|O33_yivرSO>yȑ~gU p Р=ЉB c|#ĶqFD^B??WLEq4"tE XUK[Ǎ?J4K~W6,O]pdc9 Om\ vdh_H ?#' r9IltTvo}N |?"sքC7f3N赔?݂mfN Zе%,Q?C 4@&T%\ YP?PZʕbĪ#O|0MmOA?'u/?NͶֽw.Uf~37}zsn?7Wko??wZϴw6olVkoVOժS߮-pq.ԭkkWo߽\{^Lh=uvj ;\\z{ޅʭs ? !??,cD2i-Ih?ܱК(iTtiNRB?cNXj?DDPnbwCEu-W T{\h$WǼaq܎WiFKd6f}?KX`Bjz ޢY?e-l~Yfl56d 3mh=9KZAQ?`[  G?[X vL)?+?<>"Y\\j8IJ mVI֪qQjŋH~}z*5>#? MGBQsTR?RXb@ 7FEBy?I ^GNB5N ØY|jkZ:JS5+ ?pB^r7 xHV̆C5OP~R&NdE՘gV%Y?XG"ۄDЭ߭r͵ũ ^XʻgWUZ{eiʪW//W9tזZwmmzo|F4N# ?Ւ꩒x?BTXf +QjCLd W??SH\x*;dƄN`P;-Z~`._mz~f;^駏?ww>GR7;-V tBHE1kdtø?J:SM>ؘb;j;50y? NwۃN'L:![V{حuB] (AuK ~f ['?ɟVNVٮGcvƥ:"h)gdxH\L'v??'GmM&U?ɘqt_B`i8%X x?w0hMZ܂g^xɓA vOr4q룓O_?Q񙂄555PQY$w@?R@W?+R(4?d*ļ[:۬/uN],deW7vZEvkF^oɮyFZ];^KRM"ؒ2N?'C^:OUƯ{ `|+2KKLOZXh MZ??e闞{aiG?_ 5 ?puWGNlǃABSU6A?Jevc?Mp??̑Qp< q&? 2A4!?OKfINOGe? fьD?|rC;ߟU_O }?=sL'IYVI1fgG-'"y:9 =,p?="كPݎFLb4qE4ʽie_B/?i'uw GoZP+t ]?>6}߇YHz?Ç?>:?wu/?.,ܡg?rklہK@̋IxRij]WT5&\aJi?KT7!I%zAf;kOthF뗭vWuҨxuC???fZOj ?qOZҵCۅTSFs?3OxS `q? W??jˋM7l|A^ec(^@nJPˑv5&5!whJV ;@5tͭ Zڶ 1A|6} G?'QFvnpd$B?:~H E?QI ?&??Hi2[ҩq Q^?:k\N8?se?li^UI0Cw6qV˴?XuEۋ?BvYNI?XR?@?{=|OBO@egm{Ajd<?(g/T.Aic9AlTv6a-sV+Eݲ`?2)aڛ'Ä)_N?&?'^ro<|%W~ӟa>yb]?RwVMmLc0EU[Y{r?nD⣕w !hdťlA|=:љߝMi?c33XlFI񪏍ڗιJlyDih)V_s?BV?n|TRԮT?Pv~]?f䷖ ۏͧrZ5j95w-kĬ]ÈL/YEEG&S?cehׯvu?W Z`j?cI N~?hPw!ENuG??!`sL l?L;V??]̗?? N ??s)~ao_V;3Oo<]FL?bzCY͟WjemE?4*7bUDWT_JsbqΪGFh_M\+,zQ͕U*?qKPˈ?@ {7.?~ ?oA<is! ~)?\M0A|G=?|krt׫nA5;uۭV`;?6Z7 B6?|'.y?춐aB?n(iseJn+?[tmu%D;tum;2G:q A{Hހ?1G\ ND؎F?v'niL]s;NLHG<xz\G NCHԨjK(UJi^RFmhh`@ LQc|`wc|Y_?3;?z]?m7?gsZ??x ekTkTرkhm=??Lg=dFKj ݪummм?Itw?ᶥM:;.t ?_V?N KWDu+֋e'7zYv̶f}A?-U?8b} Qu߾L"ut6?Ҁ𽦧de^Eh;{H,Hq `)??KoCٰ$}/>v?Coͦ?Wnp?os0bTgnPmr'.R?+f"~SaAGr r}+գ.~%ηfeА?lX͟ȋe鬘m? BKVlh 󧳩TA`v m?a䳈mxJ!)HGsAq{Jbq=ᇶ?܌]Fv1< mn?ZOuZh?ötaCF?ԉt?Id>o`ġuhoa?AJʪ>?px͙c N-NZj],c”kNf~JrVZ?4X?3q%9?BL? x`*l*+?P~(i ? q ?" tDZz??t҈o? fބmJvOڡF]E1'K&u=L? ?1gP`b:u7zgHCLWuM7?fdYuE25p p a蓀mVk_|gS aBxqTGyhaPtP*aȫQ? u.*4JTFJ*5rT-:5L#:?trYB u4Jmg+5xQ׫ tu]gU?m]oժz?#J#@KM~f }msAXpWoŭC9vq?n^TFC?_o<ڬm? dz\ z囜(R:?\ݪW6FڨU@ړh?utmF&.ig1F[\?A?ؔlH0|`]Q]aHИʀmlңC1#9}7s=\tHQmI?pC~["??Njs_laX^9t{D˂p1nO&/{RL"}:9ںxym?Lrm+c'7$mJtHN?=?;\M+c*?}RWT{d[/ّ¥Ÿn!nfQĩẍ́gX| MM?Ӡw JQ sdی=t] ZҪa)ȫQ\T 2?Z_F?ЈM?vWj M?JD~ijF~P QҩPREZXA4)?R\k%?V8Jk(C^sQ#?3B,$ͷTȟuJ!BFݢ?VllU?M[q?l#:T\k[WJ]wrlz???e rf=?u?s^2Ӯ;?#Vf??ƈ0{ 3?}zFv(B?]a^5?bs^!:/x_zB|҃@KKLkX啹*ǠbR7Б#8^;g@cwoW{;FGHgʥt Z?RlIg1SS Ǐ'?O?]w{~yN,~v47ַ}׿͋xw~%?Դ|00gS屣LG!{^IYsS¸.Ykc)q0ZX2F>V{T5atdVh mb,~(gNKrK{WſVZҎ Qc]'mgo)?ω}?T?+?.+Vd?%YhZ@ʒ(Z`!`fٺ{RNUJSޯsT]FO4P .w#lj46?rtN"|ovhȜ2Y?3r/{??КzCW?B?1[l=hzg1NTPwУJ$YFŲBJB EkEҦp.#9EAkJKSY4R|z4;SRf4a-ՍZZpy;S<{mA\1'te{7Cd/ !a@"#/ L5P"`"v}b?Q>i6Lu:xvŅߝZ/Zt{yaziR?lM[4ւaժXpi{kbo$ ձ??JZ4IBY4?K? m$~C)p kLKXaE.p.FH^ٌG.?` 'ϞϏ Z;0?״?ALлE j /@ϓ|PC0i{S8m`6&I?K~˿PYhfO xIO%'Ao>?^B?}ng?ON kakOt Ռb |k| If\"-A/S(?Єd KXF 7έtd QFvPI?bGչZ?R]Vg+XkU}Rӧ 5xO#8~KsNs{sǴއz'-F? yp@#{Nw b~KG?㠣C`^0䗆tMIkHK"?d:?lP@k`tԧb 3c:?o}CT!GM n^Hhnޥ?D)H|e^@8s SE?ˎg??k_HsDž?YQDE/+܀gի?Qpz\+|r?_ʅjcSGl(e{r~?W p~?UjN ڕ@Vm?)ӵƌ, tb uF] G`&`SG&u!?ĊϷGX.6vO7G}f@1ڱ^&EfT2K6nY$˖ K6lt?իW. M\(GECM9QE J?P?(:CDRQoQINv?Dq+iuV+I: J tiQmkȹc,m?ۄjT!@i ˘!nw@U9Du;kB\nJj?kNkg5wɢ-3??\;!E ZA *zQx?bj^ (~s?wEUA 4vinwEӗ..#?Jo}Xxw&:8To洞?dŏ}Q-ӏ1_ZoW*t8 Z\^>r_{cxcIbx_{g+OɅzsMn*?L[w?OoZlvcEBW%ᤰamB]^5?ސ/ M GUXnEeNUXni^? cue\T;K'ʧ4I?.UWQ>S+mv r,:? t"0&"vC k.jڊA者I;ɷQ)ʿ,xp?mmW}Oϙ?? kx3*h]"j9zB56XF?  D#w(ly0 T FKkdT?qq꩕S?&۶jòMYHEP sQ?GN?ACG?|?E׍fMv,c:m2X' a[ƪo!Uifz.[ME?nL[ߍ~+~t~w;Z?͗AkuHUq ]Vv}?H ?烀gp?3c{d"?hA?>r/?CcD$BN>aէtވ?nn;}??@쇜?~}j_]x??O?ֱEc:D5S= jʚ[Bդ|?헮?>O@tpulñ?Z?sSᘠkٴ˒l]2-%PLQSҐ]DmIZ? ? rU°U@5pu t\-``ҮKJTo \WluZ{^? ?]?Gl׀֨? tVǠVk?#5ju?:00)5? 2mXot?y?w5ȫƠjCBllU?W?ΪxO5%fݐ3?KZ)fT Xw?=ЂZe˭pˊ6~lp?urV?Y]0 W7RBiBk j}?-eT]yRG.ǎfLcT'o`4:/@ZN?[oT |]Z?FQQo$qBpDQ kc?WV><ÖiLy{7wG-0dDH l#?gfz`W~`??0kԍ~{?y_`bSG~ع9]l떽aޞ~"!"ɝHmv+'E徬N)?Q+:%12Ɯjm;oic_bYpջ?R4??^Jy? t#gI?*˪Az?\aք UT¢=S UB.)?6??1d#t?|lF?c`p<=Z;*drU}n~Ӻڨ]KGB6 M,.N Ir#HsAqAן녖l>gd?}n]Fy?aֆ(L9z&< ?}~`ci4A%zVڙ2cEOF?DAX*7ҫEnMY1Pȯ(EƿꄦjK?RwG3SWlڴ!曲weaE?5+O73 uH?G(%xZ =?1&;N?NZ?ŤtuKaƩĕ_ZJ <0FZG؅t?y!$q+!^ TܒPѐ@ xq"[6um#i?hk ϰ<]?>OԿP]Hf?H1Y?*nv?@?? ?PmGxQ@gP" GP,ST?K<qJIr?iv)?}|C?;:}ӓGcso>X:[9˿D??[~9Lɥc ˿Z\ƭ}uKX4QԵVs F3jq?6*F X \oaEK*?qPZn3f4u;N[6!1нj5_M/?pc(9ot㐸HoC|E ?bitwmd?AWI9~9kn߲n6WߚPq He ^pŶ}?CZf#&f ?d䟃G0̦x3%S-ʂ.?4H??*?FT?O?C?:^b fws;?yqz;?(aMff i?#[Лgstr٧NMbo^VPY}/қ/橞p)5Mf?3=]VfXH:9*RMxS}5ʊRaYO,)JQ?˂7CQ4R]vWݸ?[Hpu`w/)?q?;䷍SC/=5="A .PVk' K Y?Y?Yjq!??I6s6~?ڋQa?o}~5 ٶXd!X(R 4S2^LI3헯?Zoöm??  І1q}\@s R;% Kh%d c~\kRVJF9e 7@DG,LkjV+5pQ?H?v Kջyjf&٢ѬE??둥mL8>tڡvwh٭iOaU?`ݩI?Z}q†jh|?yNf)dVViέ-?mM fPJaĥp)^֟Hp??j='>%Ct?`Q3 Mw~BTs\ZݢB \`> X82K 78{NWPQY2-~e$qί,DzwsLE?C_е1U>Q?jOYBS6z|'2*>\^ՇEgE[?aE^E,S܄ekAQot)'jꐬ˚3z]Pg\H痵0,qIY7 CΥ|r\M)bl`|DaN )oK|z>w.ou[U05F*s.qul=Gl:vD?{{h6kwIm"r[h]oUM !(KwL\ƣHħg1]?HZ\] `ۨtw}[Of֮%cɫ۩ޔա4(ёmm]XZt lY.[93mMn!H`?̧r@2M%ө7^X6&sB\e'lMVGdlTDZQLh ~n~2= =q/lUضk:K!]\zZO ? V?F%IqY(waN]R2هP?FklF?uGkƶKT X>VW5?M䀮uz$po?}wJLܚ؜_ۚy޷ɍ'`(\?򪨒uă`հ4)?3HYeeѯvYdlkY)?]_|?ןBw9 Nez??_*_P࿈L|GSKC?^}?χxa>gszYs[A?J\mW˻Z^۫WYwhff?\sk7ɝ]$}i@m?qc?o՗] /wrZC/OotZ/f:ŪWXhyɔ-{8^ч{4i ?ˡN?LMVoyJI Mt?$`DFG=v ۮR*ururi)7YаI[5]rmBCjH?F?tI?^~hmҦӱBbGC?eDz}a¶`A?U}ѺTJef Z Z?%LnPsunP?+fҬVzVojsutj ?ȴvEDfhךwkwGVo\M }h ,]D ?;|PeY`,wR/OT?]gm\W?!SMS8HIfqb׉c;NveǶjɶ,/wvY? gw g)QC{?C?sS}uHrZv q}Ufmmkj?u{T {U8s\ˣfy@!*CfeZן Oؿ??ܫL?Xa f8W'i] V`.D}G??cM_ >rDñ kEYT}?*WtPl~t^ 9?(zz?¦ɩ?Li;W(uyf?xW_O Mƌa,o\y;i-A?I7tW)W-`%L4I?9]`d7nyMQQ݂%}Se Z+gMbkk_=L2xr)GNy~^!?{~ U?O>jǁ쨅p8 u?=huؓ {-o>umoA[ۛ[ۛ?Ka&\Ff]hJyi\??eXMQ$NYUT8Mu`l Ұ?ȟnشm BZ3W!??:? [vmRhI?#"MG+x7ڜG Lu ש?uW}Xy5MI?aKIQcgۡxkOC}OuHP,5w?"ŇTt0 5??z L;mh/7cARxlyʇ]?_E/v= i%hHvx[x?raP=jha%Ёdx61x"6F{ŮI !aUJ`_|????uI ? I+V4m$j@U`jd?oj:0U&kvihA{ha,is`WP[??dl.gY9Z3:YSe̼e?b>W?|PB)^*yvi=_.7 E[lpuBFFf$lB#Qo[Vn}ʗG t?ND?;ҜHK֔~'?%?V P[VXLojnJ?N8*?Wr}HU|*!Cp?؂hE BFaڷ??zF3#Hܓrr%|?T9U^y~?k?$gu]Hٸ@eFfQ4? gϚf n}nTV^޻74?h wcZ06w^Du/wM_mڌ4C >r[oݻ?jm7hkAl '+ڳgO<vd=(pݻwrA?Ms4?y7#gcG?f?eSH~47~[%?u+M7߁͝s'G4ӔSnr?4?l?&LgX~Mײ ^Q 2f#csr+L?DXjy*v`o겙4U?@eNV. y[V.r?ҚMA8A1Gs -!ctNg?*zoINz K,0-/?T;ԤJ*c]fx&t?| wQ<5o?HQ^?rl'މ:iH^?Q$??H  ?-?ڰZ~d?bܝ???V^N?& Rd!nZ?%CZN@M?I>=z&qoVG=>3 !kYDs i??&t6}͙̔LL | M'}j\A ,g?>e2|vH??@&YYcш6ԌVյ1X| |Glưy⊦X??9p]p?v\?TjKA ?MP?vUWEKTA@:p0 Ǝ9za]jej8ܩ?(v` 7?]LCA)ᨀ?]̝?C믿sij5I` i?MBb׆m:?Lki4 Atßw7sv>Q?DBi>?]Oq-t=N飫ɶO?$F,?ɣc?JY?Sox܍0VP-?Fa}z 7pYŊnDV2(t~e~)߰\Oo"?~fh[ZڡəCut~PO/saN_8OkI3?.?K_BFUmLyFvHYϞ2s}f^;yv &Q0k{ϑL3m,?ʲd-4ORȚ_V@Nq+\_?m̼8~a wخKoqc Ukye| Ɯq5 ޮT7?WK?̶?lH?Qmx^gn?׍O%[Kox8K9?CFlȺ`|ROp` | ?MMm<G%Lq}׹Y?nNs?ZK1ݗB 肋Iu?y6ո*rtSVjw=)?RbsJDҩS䥴CWYiәJJ 6.V?H͔EW(zb??c}?6?1>VasTaun願^Fx$pDn(/gyU5m 5We#׍ܰC${?L?cG@PB 4@XQ BBN \(V?7JjP]?JX-˕FbU?rQ _nm?R%,Uɥb luϕ*F5@n͍T !I'3]NVvS_uui" ?rpҢzhka7u⥊eEeWErek?QdQl?r}߇;-ʱMoɥt><<>}4qd0.YKAraBBaͮD-+F%VRy2&?)fm?-hřS? ﱅ)Yt? zo2ٚ8~К??NƜ^Lk]FVdAO8UXKeTaKń#ϛ? DrDټA{]ɃE?к z![A ݽ?U5nǁɕ?H,?y@r[{xc{?57hԝ{~[㓞DBwP׹?xCwo5Kf>KvD@`x3?~}kr?#hoRaO Jym W2?tq^Zx`,uxIݬ],˃,y pVo1TC*{g?\>_?b&c3?H?d 3Ŭ-fL>?+*p?ٯt[k!?\?E]8Kj-<ᥨίhD?v1~.s?ubFѐNXпx: 絴]SA?AbP?aNȈLؖP\ /!,Yu ??\ QK?e94t^ B?,???n|"IwS?Md/N^K||6Ȯv=Xng d?aElX ?r??zln'󡆥ܹc`K!43ˋ?شZ2TMw+|?TbQr˖[RΨn?abf ?x)?f?ŝbzдUY nD݌E.ҕT'aM??E\ά}hc+ӛkBSay]jhwr@?ºGO?r_fS?qTl<)|,Sr7"+ _Ί(VHӖeFI?܉ۢC_Xj?6FMR*EL\؊\!cمΗ6N}5FF~y N~;ƁaË/NaS}@@qXA~QyޮoAрj^4,?U0^d(H?]”PEiV.??*'xeǑY dIRq Ҽg.RW?; N]N>JVؒ?i ꠈ q.3fg!I?ݒ|a!b|KI*ry???֗V!CY /CX[>?Zruҩp"?k?(kkmB|?@7M[`ZŦ_|g_ݫ<\ :Sw}CC'^hٺuӦM'ZZA}2lڸ~Dj2 b?Wv4fC?xWmu.7}oo5N_愞lN?_BIE??𶚟h|.`@ =VW`pۉ 91$>=$tu>?ƒmY?@⩷^r?={ \HFO%SQ!?MKoShjӭJ%SˆUqmb SG9%?9x/I?RwԮ@|gQe*?D M ?Z~ qӂw^ɻFq5Z6ݎ)4`c܀?&s~!;ϱ~^D?j h $KL]? ]0?l?JU I3ptI3]QCN1:PXYn ?, e`yJ?5?3 [lt4v)Bi!qIĺH9r|;*<0L+bOʎ2[d?A[=fHsWHLXdHQ?8.SS<Si?KCfH/?5z!q`jn r2gC,1IGo_ gF,x;N3PRV2 B[ YrZcV*٘&_?f't{Py@"F1 ĢMw4,m ؄>]vYq %(X?3d?094r+K0@ɕB׊t gFjJ(/?;"u 媜SU?\,/?f|$$ ݬE33Kス ?ELpb0u8۷#ws~2ܥXD8GfBSD?02y$bҝI ̇}Ti\m?裘t$i| 1xЛ=OF&w/[UFh??x/?-<@,gw456Q_|s4zaQC~TA߳޳?}nKhbDžl,m˲I+YCҞ?{Z ^{@ NO?]Ahj^W{Au`v tݮ5=T7ۍZu?;FéƗxx?J)F?QdGWs=.v ?i1|?q\3#S6Z@sz9nX ׏GE Y Yո ?礩8y6洀&9kT sO(?'`c|?E$e^򾟀~,Gߟz??>'D¤[`?\{W^}5Ax1W-å !?!Fgޮ]_xfv}g_7?>0](wzg_z^ʗwﷷYquڮ>[Hutl.A"?Ww鞻LWfbm☻laJ?E?v 1g ƐiCbOF?SC[ѽD͘aY:)JM ?ZRa0޲j?g CŠ?D]qjxM1Zʐ?ӿH?ܻ`^J>fq&eP pͶjll@Ƒ? eEg?PIdB V?[`oc6hh(%GWp u}?֭lX@JdI|R^iL5a㉅ cFLf'daYm9֛z ݮ;nrɭI zCtzKJ\inԻfZ?~?e[tkI M ?`*wz[L? :Oh\'C@rh?Q&??{y~VeѼ~߂NgwhvLf3?C?Fաd`\ytKdNoƥ9Τ? ą?>G[ 2RZ}HjX`cum@rB]q #Ou麏_~dm!m`iM?arO Z?y`3<` Īwxۚ1uo[&.Ӷ!kQ[Yua:#jGҖ@Mg ?DddPtl(AJd/E1ӓJ bqJSC0Y?39J^o?9Ngf?2$G??\G6kP8D`d=z$?q? DƖn?!!?ޚ{^sGgO/.G./,Y\x3,N?Dw_$zqNIs0@&'&݂éJ?MP՚ / U<@ j$ 6vOe xYCvTC7@UEjXQ4{9Ј`yf=f%@un;fi6:06?ЩrT`v][dvE,Nuw߂Z ?dlycȼt lHW'??2Q?>/،q-+s~nRa:Tc>Ȟ?SHQ#,8$ZBtq ??~?5 )aA q*wQfvwKϐ;qw+~?V|Mjk]v}ҠM]'I?BIbFB Y*v\w SCN=?طҵaؾހp [.?y~ԙ5E?Ki=-MMh˞?ڷ\ݕ7_WY8p+eRՋ>Ze-0*M??mװGJF1?™GY\\0l |?0'{1VA"n?m.D.hGrV?rwV>%]?~Rx? -Ve1Ί]TI?[?͟3?:AGi }QVlrMAd }Fs #S{D`ll?v IAF6!.Y{?W,L??NN"?6W#2?ފ?o(!^R ?p=?B ?-TJMh,??weu[{?%+ [uhW:n ?u|j_?2Sk?>ng'jR+AtOfXۜ5^>fks'<&jTL +%G,y3cPv]r?TrSV4eK.{zŵ%djX3?MG\5Ų596xbN ?î1[/XHݩqx_˳򌬯YeFIK]5rEH? O=XT#}y؇<=?CqY?oa^(?Edb\eJB?y ݃t?$Qx???h!^nN"F\@鮭C(E y;ͨ\w83tmx8Cݪ]/>98ǟ)֎Kpg?]n_q`U΁΂5I3J!˲?06ԓV#!,K[@B-u?Z!nڱ_tE2zƍIN´fw?OtAK]?[Ye[f! We<7,?Gt?2(yS2.XܱYoIe_q[b}+hF&d?ڈJ?rQQWJ\h?jUǕ뫮? ͻm gʜ?EXRGT,c L?Uyʜ|t]=+ JѲg?اxnIsկDtՍCqZ?Gk^G nw d=H48w??z;[V'g6$_?hGYbAсg\ NDDm(? Z?Om^QNrZC EdK?5 \D(Byx.HA? :?<5DQnoh}$??Ja\>W}ZQ?i?f?-K)fJ?J 2^E:UOV?4?7'Q'8H?j׾MV!g?c? `A7)Q !cn@??)/-QIijr?Q*qMQ@QMu^H‚@>N(g~}r`æ$h)\ y ?ȲB0HV",vX3p< Նw?C] B? ȧIH?D( 4IN`LI҉?nwIN:i Y7,mQ<_ c3v 7WsFXvgT3aHէŝ{ܸިcwS aZTKcqf=@^[ bܥK{ͦ=M?SRao57-сe0T;~IG?{Ϯ44#6>CZYfd`E? ^{ xo?   n?܇Ӆ?ZZ?? u?;? Ґ1jp%\JHPYYe?\?W?kU陮?Qƌ|mg??`1HS͸#Zr Qz?+?=@z9sH?al?&DY(X?'4B`#+ m+v"ÄDIUˡ]?jV=}sא?w?jfs?kj??O\?PEoof 7olk\i\?Au`H{Z?ܒ7ĵ~]~S"'Y?o]oZ QҴ??Fy?\c?h;CF t tp1?aMqNa?u??Ay&"Ze?Iz a1р̺D k0_Uƽ8/҂Z_'o5M_Ňyk?ƹEy)fc\p|?fm?b1Rq&FgʼnE`V5?e ofxLZmU_ځo˚\)? KJVl~Goɋ@o?v vY?؛DƄ -s)?\pp?BH?#TcФV?kHod(ȥo$ioZXZa?8-?\N FNPgGGGscl?<eFv)zF!??Ax۹IA?<Zb uPA@p҆abM?v?3 JI=gϬo?X̕<ƴ.mί;ʉ?W?˅댽Ǟ~ij(^i&.M-? NB?`ѦH彠ޒ$.I^z?~g{?urmmRgTbaв]íaxB]  ;zBMtӘ6|;^i.NII?Qŧn 3.I Ϟ8$=B^[Mz#~Ni' :Y P;f;i?'!NQGI!t~~q-gTfB^ї[Yiy[LfoZ5G?O ڧq46_Εd.?`?_jh#)UBAv}:? }؇9@Z\}?}六D@]t Lhf ]Hma?p8ll_~/ ?onG}(B:Arúv^j*⽽͋WJVa馶iMZV?y^{M^K]ΜX8V9Uf/T\1X{ ]\X=x_ǎ?ns oc nCle]cN>xKėRm?ċ:^n???n_>uVkuvJ :?/9?X3??oUrEx:Vya"XX}h֨kCW?t,ӶsWk(jK#m/?yHO#?BLAC"hEaJ??yWz *RR5i (%E@lMlc Ok43s?UU}R{ӃRnՆiaV;GPn?mI?{cnYzSXϬXEvih̋KM?'ineƘ5FKX0Y~@m?Lo?X۪4:ˎFbFS?D}N4wFt'3~-?O`ҭJ?3Zu&ŵQ&߉?u^ͻRzެͲN/YN 0ox?xoGpN8qevBiZQu?=:ZEA- qPdE~l,rY:Uq$ ~'.O?=^Q?VT+t?{?youRR ڰ_eaocZ^.>hQ8ǐzbeHZɑ?M[LUpU.ҵ?<4r|vL?ԔAe=EM+ԡ?K::{[R??ga![PAin𝦪z?^n2m$VyR?{Mk/٪*p6?F??i #|R?r엸 )S*~͖uZN}FD~NĿQ\u}W{@y؃uدZ*6Nm-MWiDSkZ;{?N?M5[??V^!`0ToDhXذ %Aiac۸]{Eyvù,q?GH6?Y *E^Z69k(ʊ?aY?AR?Ex'~O~Y?[c^MRغX^M?r{^T^ M$YG.ۏYfKo?c%78Nѳ7kѠ_W?PY?m?ŖT7 ꖌ41(m?06?Ϙvc%zi[|@7*T ??kk?eΨ聁qGkCV?]MPfV%~c^mb^4', /ghtׁ='@$pB6!| C'0h?~BtLs?0bhOkкBtʚhZؖq?ϰS6?ץ/V~7_8Z?(Vrv' k;vN{)>z ]HЃB?k{~Fpa"In센Ӂh2:bzZdm?Ff~J??MC*o(Šg ڢ/?6=󂻦%fvE?iOs?;Y;Nމ?j^vv׮\> t@?I?$C9y+MniDR?N V:IŽN ^ƽV G4EIOz-H"dڣ<ډE7?R=pA; [q?cWOCSΕKURxv#Yʙ"UU{.N.ivZ9sNR?[Q7I/Hy3OٛGhȠ& ǀQv =,?5Gֶׁc-HePRXP$a'2653X԰9 f&b˳\Xq @C Z[fYV?7CKV?/.VEVV?[\\?}83AhuY Pdw?<3Eaz*YDTYGƌ?~^Fp ?aLA~,?t% wlta?(pmZe[YɡJҩ]~f[{ nT c~// ?lWSO_>uSI5tQr@ljoRլ^u\ӵ|ho_5a{-rzA|K`v@@aN{unmrtdck?[ꚭ n)wܵ$|?[k$bn??K??NQ@:"ҶcLdZ`r*D 4ey6aJ_z?|S,cRQV)o_K_wS?NHZ?P ??;?]Gcn BFsmTp̜-$^dq` dm]??|@XC?HIs삕%pkH??Ƙy_ފY\N.o OGOG ?- l$;??'}itg?]*~ZN +?_pr0Ry<09%jGeE ,?+a??@ ?~&n=y;?qk^kЇD4BN7n>TZUtqf ?QJ.?jk???슘??}V,ZǸ?I̚BS6\KM֖?5 8㊜Vv> : I#B[R3D2BsAU c* qYMVAنHTC,j‚)i%7iCK(@?y,(zKh 0']hHQ NZZoJChvrn;Uu\r?v?n|?~LJW]b~@` 4*mp2Z@uopփy n?? T)[}us۶{gz7 juVˁxwnl?i?ZE?ҥ"{!?qEcTp1Nc7r?sʜ ?bJ, +&u~?v۸?E/EEڦM)j@NčԵv?Ֆ%RlIEkER)q ?H@/WыGĐs|2/?xN_\"KCx:qA԰A6S8lͲa€A3 %B?ѐMo7]A{#r2?s9aLm@BT{N(hfAA.^?h7`]!M4| &WYsmQS?xk1U??N3𬦂fa53"9զJ|/)*d?rbgV+-J{lVu/?K^P٬mT{?wy}!7vmeNl?H[%"7L^?혵[ Mb|?$*M ̤HϨ?=7%ŴQ }u :vuK.0){?zTjPWrmDhy;?qyվ@|aLX2-TTu^??GecE]\Ci??Oc'rpntM8]7ܦ Y?ºHW3kI[1qsrqL +Cy|z95L=HFtr6??ӷrY_ΖKI?_Q%vTqͰ`ᣭ IZc伜},HgtqfH Mev;ݷs}ouIUtdA١&>unO?Ri??E3Fc:m_ZcjL??DbOOxmǏ?d@$?˧IiEc #0F~7܈Gw?vj?l? ׁ̆Qe?1?ӎC@Iw<_!hi^9;팔?YZ-ibR7%EMXhJDDk??;?s4?*ϯbZmCV?baMc_K^?v BǕSTM9:ɬLVW&bAƥ[gsŅ/y8_ ԎH?VmG_}L^?e)ƦG eʆ 91Jդc-?v}&6HzbM-rLY?wg{>JX ` yhx^So1W (87?tteoWWn7xx-t?Rt}GvƑ};@?OASၽ KBN\Y 1Å?[6\D~Ĺ%Kkh2?^e_HLx3O[(hpvU& [Z~rb1='JjZth?+]5?oA+} (WLin+ 0Cj ZĈxt,֥p>u=~cv}Nĕl\t>fdgU?]:n?b?";?Z:PFRfGq;cU?b?`?`-no 7h@{^tzjsS'OB wz]r8[7mگiAlzGn-zWl4+Oy-F??]{=k{`@CjzӅZ?L'/^{{^oͶ`?ݡ˘u?{' j?b?#?\hWo ?L?D_^'$j4l[Aca . kQɶ $Pڡ7v?r)a 0':}! ?CE ?!Hzd'?ʎV?? nQ{Dq^-??[Xm",¥펫kI:ͺȴNr6: 5e[%t J1QfG+;Ћӟ6??K_EjUjVj9eIB?HBHp&?m06g< $Q_E?oJ?0|#xy?rqY/QLIס??U Ynz? %v_?Sj(LWao?v!*D@?/ct`QrÆs?~bEz H!Nl °P 8  6 XEVa `FPV4]uAUy ʩǏVp+-`(M?u(m%ٮ﹞{ΎzΞ|3OIEibOH`}&fCP͑D;IPPQOӂ9'krf c#6)iɤu1i bqE?{3L U?z֫|uC뵬S+?˚{ m% #Qf9$?#["tTGWsv]RR M/?w(I?ʺdH9?<Ov됙sslWSԥ[ I)>6HFԬL^L/? qض>8 ;Rc+6W̧OvA%+nU[JNBWΐrKe[°X "C^g.nl gw9˙Kg|?tOC'tTV4G?YDֆ̤p{qv?x?\?s6lSw/3}ffcbk̋JEe]íқO'T\:TîUU@+?qfE$^`RRnޒhEJcOΤ[f,Oj6O~?m?_,?-+nʷ:JeC6S<6ϑR}]\RTeBISr{yQY~A m??I?Ol? r.? P& `O_eTEp#.sk$j)O];?kGS2 a>?Db txjO *#Գ\ n纋??ņLo_?B?T?!]1f]b[UH?uZr + [aauH  ?IA}Vߐdʶ5ojb??W v?+JZj^^cBB$dhXtF?L^]D?%DزU?i]etO `K l;:Zk`i0 j j?/?aB~; [i6c~?FAEv렛`̶A jF3a0 ?`g \ +H,cuXjNְqtI?Ay?dߕkKD]?,3gW}նt&${/ta&K-eVTK2`=- ^@kߴ}T*&?ZVi}S"?nl.5n uilK21T}s\kU%J]z+wKW͞x/{Fy{doC酔G)3F^eQxY?gg ^?n?~I3| bJM??~r k` ݢETcQ?iNViO)"K ՜nO+?_a2iwsD?,TRyF(K 9?dD@ݽ}?x~rmF]X?GGp¢0~q&$gQopYiEN P?.M)>EH㤴}O?ԏ>ڗ~kT׈@B=j`C-V?wqq`fi_00?̔ҖitIkv'v;NW|(?[dյ[{ߗv%PG\3;;h} *AE0NZo?$]cC,vw-X{.6UE i vOV(r?57k\l?rS*?+QUQ[*d‡)][cM[q5 NJlLWY??c25R^@v??z dz'9qB5sY?.?G?%>+[uR׀ h Y? 聟 ?uR'YF eN?ױk({e ` ?[{ν{ ?eV=GAit3{ۮ?(avٶj9?P [@Ԧbn,HQywtM\HJ߶|8Zh?|un6Vtێ?IZAh??fM >eêe63E}Yݚ ݍk֖M?bdRGLt?#V"U@i{N~_rI? 漠<iflۇ;a(6ͅelCi\lY$/F{ wIm,^HšIwVSo$~D_>|}dutz?;n5߻q/" G^_G?_kTOeiGl䓽sH_ygm}f?Z]˴8?{2q]n\?]c,=]xb VZJ?|rKE4?L w.껡?ȼD}cdfC?IɜYMԂ? Յq>ND ?9eoU~B?WPՔnK\GR\O%n{Fjr*??J866Pvbt}! BY5l\ZXaW?iX?_FcMJmZXFYϮi20iE<%hR. `vf?WՈJ-P[k; m@k(Κ`yUs3yz?=BvsSr oZֽbZA#p  p E4@/p?Ze?OKoE~Z?WK?K ~#_d4mf0 :I?d@ @L)b(0??K%)>U ?zSpIM IFx!-Ky?(UcYZ^v/.DG 圊\P4u4,|L]E!&Y[3\i繉?lèS3Us*-,XUwru|$q ,~_^z{`CdbDU|Yo))up@ؖ%ؑhs$k_)(Y8r?l/?s( fJh~ co}Bj?Qlo?Ś5uIhJ3Y6[]wzncZ?Im][*'˛?4يwlwqt }~|\o> t@'n?Jb\E Heĝq0/l體Қ!??LXU5$j] h@/]mh:b(Jޯ?\?R4"7 U4GF"E|H~Oa^sEPʷd/Sdz֖0yw4L>>ׂi `d?c%MSl`y}? + ˱q PRZe־t,_^eN6x$;זH&JJrI,ОBtك%Ɖ?G*TՖe $AuӂM~9LNFd9 4?jgk/Cjy b ?U v~P[??ipuHG>8_׍?u?8'?oNN@OOVMF }?[D`ZۭDmDg}A?`?_\Yn,|uOÞ)jLW+5&mJv r@ ]ێbA9pQX<+I&WҶP 9f_0JI`s<+=5 H`IJOoa*nQi?)?mjU@JTw=b^1?-<ϴ1dW{>xw[~z-j??f{_gvomD~g?N/ZLL?8~? v\pbl{?hQk^Y[ksq?L<clb} LaYkǭME8P麞kXj)eS?:ROɉkYH5ݯ?5ᙔ\?9(@) ?Ba_Mva&ldT*%ͥxqkkjztO9?X pa?ȹBߝlvMHOE?3Aؒs3e.YYEZ@_LHٍoP¦Sɤ?ܶJ rӴeV۝+FM?N rmi/TiLi0:?KTC?b,a*?LKTí spA~/jgmTMj on( { zC{_i44,HkXhmk*?vvR=YF3|?w?6q+U?U vpNVm@BEEP`RKH?wH$N۱xoIl?ơ?==yf<>?zޘty?o;%f1?BJWqj ??dpZJ?. ?NEMh_P7j 9{P? ^ {b?yFike ?´k  $ulwD?ͼ@~uDma^ꊆz&ha(Nݔ %:ZV?A5N[dz;~Mo%2 XEdՅЧታsX,?R?W/zŊ}L£fl}zcgc}nsw#dckkaַ𙍝f"tb Q߭wX?F _~u;ijqt$7'zM?' F tB?h'?J:Ot+K+l6+gޛ6]D6'?C؈ؽ0CzPM?F:.WEo,񍡍Ngt7sNqEQxV?^,]ˣ룱?:4Wq?}L< ?MW?.QRyl25ŲBHJQjGjgAPmjqUy${KDSJ\"E9Wa|? LX -iXhA1d3fdZG[g?4ם[hzvu C<;6`gab?qSfta#?ߏSTD<bO`v 횚9X OX>n=G 2`͉34I @t]tpI?еEdV?3QD;s {rBQ5EM| e5q4{ג()Pkzb|rpgEhayAqO? VY? ?-:f+K.?wZ2?Zo6?JI v2% ^0DH;iH kP[,4qJǾ?r>DU#\-auR-.ǰo W^?E,}M֓B,%!AaF?[#_?wYl: [`?W`Ol>zzy6x@>;VbpJIg7DC$8 ?B_,=Xf8Lǻy?j9! >vP?^K ݌tb `szq?u&'⁷B ?s:bIQ{Kga5 ,? !Oj?|lR7F??E|l :(?FCWw0MELŐPuQo  Hdl|, QS<8X|bNyy(uԽgz0?Qv 4V?B"!g׈LY12G]uy{?x?m?>h}(m- iî?;q?mYmՎ+[Ôdݗ%Y$eH.uo cgiK ᱳ? E:)an?:,ʀ P ?/T? q^aAMA?q|yZl TF\?^8X `p(?-S\Q-S+T[Ɠ u2{j_ȀEY)' m ~[ W?[шDib̭QBY…?Wm]??L gMնM۶XZEQ-i jvtT{G?xNp?cȧxy2%f?tɗH\ X[8w-LfHTep5CMb R/-[? /MOٮd?i#qv\@ Ɍ*q?vrFsĎq{]W, k¾.?>u$EwyJ9^kj{> O\Nc޻Ti9w̟%7?qQz^~x_Ql>HN5fVs}[EG+a?fexwaA4A.>ͦ`ZTLVHཱྀ-κG??טu>y띟n==#? -t&9id-K?IpP@ZlIqK4?bb)L#T&sŹKKG;2ҭS3`9}̵^ɒ!ĹP}[7c#7PXIzĹj?Zd 89Ħi?ZW(?H 9, ɐj@2.Cӊb? 8 KP֗Faz)=,W?)DKzՄob'bfK.=?q??@Q@P 9?E/avZMu9xKNHdٖ,VZI?%ه?kܢ -О}x 9 ?CҾVYG ٳy,w2?V/r?vk$v6M楢N ]A@K7 Xڀy%jkjvs·wzg.mа??`m$BwC(?&IW L\@#G n֚aASp?I'h"*?hX}[tbu?\?_䚄h?2?njυ:&?1:UFW z鸒j >(}Dzm=:?9K?bX c4py\RX`2| V~1?sZX?BE_ʢX?Gd?b@DHb2^6e}C%pOlPXvDR)%r?}\b^`n*3AIA^]e?)49]Bg鐨c:??QrЇ?~_GO>^FXKdurAJQio:~Ӌ{EuP?IXOv1ޮ?^qjfje zfJN}9)ǹ?s|{G^:;ʞ6:5J?s#ʒV]ұX$Ǚ,2r??*d?gzެ_|÷c?P^T Ahs}t?K/IRBM|RZ?CIWw?#sW}TM>`[DKeV875RڶݫXtP]MWCO_OZ?y=H[jm_n8n??rfRB<|*R.* c?fڎ ??O?B??vz!:ǦB4餷\ph^Q96FxS:hGMUɸ仇^"2?[^rZr?.]/)xjv rG+bNb܁?tCw&/K!~9-}6c`uhLEw_=tdo|tb?]ѷȣྟBy}&mԝvTOUY7x0W^?{xY@?MW?dϦokY;; 4?& rW(EM5Tnz?,톮 V4 6p *hwkiu?L?~x|N?o ??(TR7 ?? ?g@؞b?h2eXYJhdqUUM]55‰Y&|p3^=BWNsf(hl^Y#dB翜: %4\ dўҡ7c\?|x,Z{HE]ׇVkBzY Q1>[ k#Tv"?I@ׄ?LkY:݅n o]*AZ?xB?u*L/J?o:Ui*V5[(+"jkF.u枉,rCkwuK1\T] ??  ?cՠv۞jۦU7mXh?mWDmv7xCANڦ𡲶\5ÜMS) ¼'}(aUjI^!qz٪|o?ꡪVjU](*-˶ ݲ˵D!J?KA.?qN;v{<㱜!ڏs_TUz|{Me*W*M.H1 KIc`v6Y1?e 2YY#W։QY˔?) o@s\ &?)]tS/wJa \4Ҳ[OH+X֫kۯkݪnm?v;ݕj㫠\~TRphBb},lV?t6]lW Q3>J}bKGH.m.?Y&oJ!j N.]>Y>sgc!jA"e2nֿi;j\h]uٖ ]Fk 灾oArj?VJh!8snŸqkt.ײBєhS$ hũ`XŮI.IEǍɖbp˼}#?E?4dnϘEx 4zYj ;r^?$xg]} wP|Bɔum c?HЌv~w/. וܙd'-@:uΒDdW8? IO Y)o?2VxBﳞI?Uz?X,<<'?^F,}C?0S"2;bWoLFTs@?}GC_ ??|S]q#UH?WeA@?rѤ??@aZ,*NVb1G9D9U3pZk`+esҦ\!ۦ{ڀU?ioTPP )k%?.lNt?}(4ٚ ?BSS,RdB0]UU0tRba:q ,9A^|^TnqHX!Sd[~??J^0HI LA;UɃ? ?7{9P,PPX?8㨌pdDTX?m"4ICpsɊZRr{tiηΎc=h(4JGd10FɌ6u4%MYv$.L*\F?7A bZV贚Y;WsߏlW!ea?-{ѸC4e$ RFCiu? dlY j9%b%m(lXk!o]5xF뽦b7`{ƕKA߱(@N@?'ZBǮGè<?KkaV]`F- ?=M2,倃pa$ݑL\\̶@.tg|ùu"IF謇acF@gC~}ݱ??ji ytMuHЉ4zx2!ӳ|uZڨ1 ]N>:PLΰwM?4y{I7Kx۲gMuO9\qlFxvA-S67'IYj@uO ~[?:r꠳~hcfe%or|?JJ ?zZVP)3>'cuZi/.><|?f ~3[OdHW\~?x_ts|No<`*bؔVյJ5_^G+;*V}jkwmnX onlo662)Ԙ[s ` >?]ߴ{{?l)` ]6Uc???? {Fg fg͚t- !KE.Q N?T?"?ڜzb/NtaP>u!:=xto ?.覩[&xZ屔0?̓uxON0gywK}^|N????$?(v8Ls`?`ÒOɲeKkW+K2`i_e>L:?g]hWvHDZRߋd HkH?^g~ڮő?>Aa?tvsM-. iUrJa4zw杅w kh?XYT!s@SDyB,s Hyh?x+\l:yU@k6UB{W#ы$j?؞-onp?{?dаuou]T Qy]`?{ ??L?eU-}[u̚cl[vrj`^U W?U?|gf;6oNRFEXbQ?lFAcӪQ?|(??!IBWE3.+B2H8?a)gY?ӝi.IB@0vZ? *"!_J4H݄GpѽoG;p%mF{uTa=&:iH. ;_>{?{bwUe>dEeZ/?Dnv4|Ԍt棕&$)?*4"?МK/Za3Vo 2ފN_O?|EǭJ̴Reg?RqYvݼvpu fo9?ȘT`k~RqkSuVyږݪl޺]jCط?? K?s?:Yr@9$'EhjzUA@@r*8HL@no"?"?s b:`Au B?&?x07br UJ;չ 4ћtkDjQ}J?M8%gĜOb:f(վ¥"і$ ^r3ȲFOGCX?pcy<!SFwD \Ƨa?).2\T,dd l{|i'cJJ?+cBlJ )-i%W}E ?S!mKs\^vM@eœsծzm˪Ê~j@ h\ۗW;`²|j ݸ ]ɥlLR @B`“4~V@^ ө1l r8Վ@_ 'JR\^NΒIt"?T$^W?{57}wB?f?Jz?x_)&9 UH`q6M2ɤlUIt6ו$?yz?G ^\9vZBg@T#ѦPы1w?v?nZO?A"j2@d<)~J"H?*P? (|?.s,;GKɋ%d:/)2\t**[z?m۲]ΓYLҌDDZl,Ӳ?f_Mףk{G!G=WSQmAuxt*?^_6?ĭt*taғfrb?Saj<"+hlEdŒ$GU]PS@?T?nE???rfhd`ʖ Bdޜ#Qa)ڇI}@KNE[vY:<?o5k?GPzO_}'??w3ou5&˒2dppGM?asUxV?6~}jJ9VĮ3[\GSew[j]4M0?W?ĚdHt(?!9` Ĭ1DXvmW _ _hNB4Gowv`*?AW,ggnc1҂G{IT׻¾3V\?fݭ֍-n?^`Wv`y?yP)ufDK*9ʦt-[ vt-9vFgT^}0?ˆ @`AjhN`O5H>?_iaz??мNѾ vS_bzk膹;x#)x~r.D.Ǣuٌ?2L`E]5BO*HM?^|?vNwww ?6@Kk'ߝ?@\8?3Tdzp?*]z0Nx?v}ۼ wtuej벧#\[=_ċr4@!P7ؖlX,?l?zĚ? JQ?e? ?,9Px]\ƆY \$Ҟ'N3T/|ca?I45N±49{ viQNzٰdݐu]ѵn8VU^U ?G?Uۡ5N@ɋ}W@$Z \]N)x?W f^yWG Jɬj? *Zq?? 6y^M?6)?i/E77((VT6CU?R@/Gii^R2ns_goi\Vg<ؔ&ڊz.ǰn.޿0qUЊAfh?V5bYyU~b֋W;{[V}GJe+?1 3Ղv3.n?BcuD䍣!JAM?o71x^r?X7Ԇ\=|ޱ̓>T}Rd\<3sJי\ |TTy?BVW.gt4<#Z? 8AMr*;(v H:hVadKF!$E$yD?I1Y?UŬ9]UUX˶?ঐDDW~,S?I(ZxTZY$Are ] $! '3mA IsP>{ ]la>47H?WMr 3P3q`+?$ dɖ[Z}>fpOu̪ G?.(l`]aАd a?-0?`+=W )v H ?dERJξGY$y/`??S?XD?i76x.t&[jsbw'Lpq?YGrrf-Y~3M:a?M]T;c+Noe? ^l&: ?DGa^iZaƦVyhV?l ARG00y-tNY"!t:-It?hũ{/SPS?9thdǔx:!aXZRp yҏ 11]?+TऔY|YXSQ?feênp%%tmM?u-5QFr:??LL?@r=?hb?h QxDhτ'1?,FB: Q)?I L\|F?KI?ɤJE4 !'{S]|e?6?BñJͶl?DVSI?`}9=0 gQ4m[A6B;Xjts??3LSi(M[?4δ!?&ƖOm?dd[m]JZI^di/LoۙE:fw?@뜪@ެH򖫡nyw?TT9zw~ \ק??d-1 OZLMÃ9.JR ?C!o ?@ۃe?;JQs?e'?:~Og76mne3͍Z.BH>+6yfe^X{jiƛ?koV^^/B(\')uh^}?"qC5IP jPECʖaTM ?ԭ8?Qd< GxN?h'3'Xs"bBj\A? hLBu4IH?E-ZR9uV?r#Ӥ1 ᴝݙ7]LIWagi_Ѯ y?~GRN5]lTǂB[?4跻6|ᯢ xFagRI.{T QaM?fíwl5ǦyZnIX<.3Q19A:?WgDQCCbOܲLh`MF?Pst8~G̹ Ӑ݆ RaΈFiD  ^xZRKR)VI*uhENkTΑ]P<6):|?z׿|?Ű`H4E U:m4Y:?lj^BTfr>Ƨ0F<2^M3?wZϧg溡B},kxYۅ7"M_޿?цuf[.+QC엔^ggpИ ebj lUer^svÒ}zzGa~񤇭?f[`?TKȢ̹O=xjNͳ%„G{yz%?V {^UmUS_r2xAM}k/'˔ZϬ??h9lIB|?gů[5KErcIHT'_8lM7ĕwlα?v#Yej`uj1{w{? "+1/@:? 9;Id c?G?CQ,45"u l 9CPGH?quNKL?~mKdVQXIceu-uQSւJ?h?V֧C z ?@`]ȉRaDb[p?g/>?C`JegVW)e!_^fJklazS{q??Lk!?5x AtaLQJN^]sTr堒Y`c#d?LJYoK?J?tLNWK\JN JmH;?{/k{՗?kG B?S mlx,ݟGnqix?v΅cܪX5J@SJ?hQB??l:mKjrFOuCu1k?\h xOq| F.A\ {G]ZǗ*?qCjeV+Zk?ngu ]G?"EgY7,:D?R2W\?#Ș?V}ODHxu,^ZF?q0QuDz?觪_ZVUwmՖ?hq•@6L$vNqG_?<}_vlzU+_?z535a3ٸ_\Hagx|T?u_hdFN&zz?gz9EFc?_&RQl Ѵ'́ JN4G3SR.G]ryܖ%P:]5gbށlfDf|?;V+.wqD#EU|Au1oa!m?cay?,n bΔsC{2bNHwv_ߕhN nMu9tQPe??D_b t .oL OET T3+{lUesgio?hz/@?%Zl'2y%kC~G8rar:c? *YR\%? ! g *Mɔ5;z9;ETQ@?ń ??IhBK.H b>b\R34? a!= KY|? OlKlf?mV YN? ;ey8v=;p:MK?wuoxcynlUjEشV~mG >OG~2QЎ? c/mÜs;{EOKk*0BxtŎ1쬠Lx?dZN;y7˻#r[~ա}Z6OWա~5t])C?n TZv ݌u^N^j o??(x1vG꺜M2D? ( hq}grfd{utG/JIiz!^MosE=MPU"SXWu\M6R {vֲcK{H@ZXS]?&{# TA7TM?jÖ5p\m@k?3d2?? S\~cj2aX?"ةJw mwzh H8lׄv:VzɾhF6F*5#Ghq#?滿L`k:^OE|qoFf>鹈ͳa"kcn ?qa?FbN[UJ?-y wR|?v?㝖@K:C%䄟X q4LaB< ieI?ebJ ,I1u8 ?]rk??兀 I;D?`DCMMR1REtऴ;jUqQ;UK`K ҞA@hb/N4[_BbՕy?nzul9wnFpnwu-wd͟tfny >uvِNp/:P}߫{3N??zGq7h j{ѱJu)?^ٕ,?ܯf?JWj>puՅ?ڭ/W>vu_󛂍[I;ӱ|?^60?哥O-A֜q3mk?wɉ~j:raV"Ok GatuqvOCdK3pO ɛ㓊O_$2?Jb*5Ш.BbHn흟K;Z[U?Ȋbﱭ[I4t1Q?8?N`ixGPvfjO4Q>섨'Y A wH'y\4(y! jN x - jQ7@jA?ڴ,(q]*_?PRJJ?i9 @6>1fٹ{fw ā8ES۷?/y??wf~?_U,$خ$}L#>?*[2KgĮoG>x~瓭VŠ?Ť00ԗ9~w?pi?_8a#'?mMEr%#aگm-|@?樼Z ?ç_cA \c`u?;ޑ?urտ| UwSY? ?+)lT?¡8|cHqaף_p2L,Tpf ??0{諭5 CrlM@P?oY?fm |l임C?GO|"?9F??ԙƆ嫳A#=|5%QZg ^vPƖ$/R")` KPzУ "L=Yy?SVZcz5gqBP%}K?Ǝ溤e%V րӾ~ xż|cz?4߮lv{}'ir SaJ[#CᑛRPʍN,4EWRωD?!Qs 8hW ?݅*`)Jw \l?<9p1KFG?y%顊K_?gDoRr86z!m6UVvwOi丹^?|} Z$7 ?jtwm. \<'ꤡi KD^?cx؎i9B>6ЌJfd"'Et|\?1JJȕY2F" )jѰW/Cl'؂XbQ**78pVi5_DA?4 ??sbI?Ȕ ZQ? 6uf˨F?έf?İ,4?O 嶺\tHmf/3_?? #?ܗ: #dڀ ?dJ?It7Acx?vֺֽ?nnF`:NFҮ',Wӈ? 2l<|r;.Pʠ?5+Erd޾n.t??B<M!B"_==?w7ujs}BĔlÅ[tT)/M=r 1]hdiuރf??]Mw?EZiwU? X]?wR !a9@n;$Nb?o'c{=GB ض J}?Kf,y [lUZ +JMԂxսbnyqtqkVn+iSznlA{/E$7Lv}sSI7G>S?|?y&.'2~žCu^;C٘V"\j`<=)빯>_SD{[ m_Fj`/?Tŧӡ+ix?́A.+K) ,/l[~;[olloQ?j}nlkOJM{U?~a+dA~T7..?6v ?'7?)za]ef?LS? }A?>Xb$ T!ȈuWKTaaxNR8@x ^ uL ?UЪ@SN]K! }s{<ΡbMy <.m_||+d<<-3 ׏FnYb"^_=O?}By儋9؞*%{X|Aٯe^mwޑAR c[.F0"-çs޶䷇W> JñNSaٲ?!TRUY "S ùo>?؋eBv rH%h.QYB4TFn(iU MR l ?+gbhhUA֬?O ?`hFÔ &B!FE$/!2?N̊pҚ􌤬m=ӝ^w|s?Ѡ &k?L*?Մ. u fJ҂h!Q?O??:4DQQY+ZBx??Ae Ih&)MVR?#6?$گn MĚtmejnҭuMz͝Wm?t?8?w~oo0-) A`Vd~ ؙX!,k_>i(#jLﱤA9]r?fgZhqrtur}R.`CX?5lCC7[?'].L‹SN<0t3X!S- jޒh(u,tXLverCƸ2ڎ$ۉXdUfS?SoT|vOēNbj{tC?lpMl`⊘Q ^Ө;ۋ+snimPpt^6|UE֪2_OTTw?:|؄GGΖoy[^(|q i ?ӽZy b 2YMC5j fhO!t* t!X?Fi&Yo4ZA@#56TaWxQF ? sEƉw\QYÞ?"RUKyQ؜$ I'D4 Ҫ5?:~wi&bGCR1?{?9d1(,BhHB eX0-l>776$MѬHTJ-0qGOʆiQS̏D_Ner?BV؊J]?0T*] uUWeS??Ul]^yz 5M?G;VkTyyVko0+Q\n,ٿq_ z aZ hZv%<:y:D'0HyEH\8?g_(+?HI 4"?<$(v~t"#?0մS?3ŔBxf?[Nεb_Kj1?im{j弛pq?K89 pf5 Tߖ?J֫?^V27??wޙe ,-j+JTk%u` ~W5釙`(@ e}dA?t.>kK; M?%?\ <fpOؚ@RZhq] e?US,d)%CGaƣ\?F-qdɁ!*'K5 n N6?ՙ쩋fĝ?_kdf?& ?}OXEFtl|G@{myBÑ?8 =?w# >v?xE{WL|?Kagd*rtxf1aCtv1IBW?wP?1Y{x`Wx?GQf8 [.Tzx[ Q+U\]@hͫ%A?)ɜGk???k?\] ?MܐJcV? f~PJH.Z,? ?&n*mg"I;X]&odAnf+*N&?QL]w_K)O8J+cT~Zph0d E"mқ{g|Yl_lT[ tGŋWwwv^_Pqm194D`I&|?\>pӅW]?M?s RZY̶sOb^a?ȹֶ?Ɯ?W3k"?Rm?Jleنm9_M3aΫgn?/_c>u\ɺp]K?gTJnD!nh*?ZM[nTeBr K tJݣ >y1A:s R،^[J3Gc}r?<^X?7cDz_K >zN~mMll4G"U]JP +OyXu]A\Esg|D !yOi*&"^.y?AD?k?If Vq ??*-kzCеXVjS??\ُ֯?RE5AX2KhGsIp # 56X2)RI Y?|Icـ0ܞzpVTjU??=~Lr?U2D 󅐐rfDoLZ  9H]g4@61kVn׶j-(̉bv?*imhh?FD8"ȕIlc_J/?gzޱ q 8LH:eB.2ȖAu&Gf;3wt?3ԚRe|m??4v)5LlJ"2~K0QT?? Ze5CW?o=NX̍3L& B~v#?v ]e m*6Wmp0{ۍGJL v?CGf,xY>T$]QA?𦤚l љ\އ A _NODj#$_,J?rI?Y?.ːV뇮߯2b] ?A-Ɣ iA@kןkdGA6fωJyTR| cUhֿZq;J=%|yki]= ٸnd]?6q !th]?齹qKǙw]}eDA7c6Z?;uyguf?ۗ8fcSt Z}i 5t1rʵSKMHDw䏿|{TSjyl?H]9M !>፦f}VMEaONTL~.>x*äc7?wiBIIw\M<%j@6xr69GDH;WGmĹ?dn|tGσɁŊK?"Iy LWAe*S[b9uNsܣ";؏Q@ X;ȌL;(jȢRe`7?j!  z˺hX5ʖaȪ Db2\ LWfoPFZxFUy ?]kvFzo,?ZLy(:זι8:/? O?2^ ?.w[k me?>{6-d:Qwk:p1!Y]j1SOZdX%ts/ϵl?ޞWUvkWCCaJLpVtOm9%4z u5]]H?lSg?bR3r&8OlL1 f3faa[B-?I] ?g9:KQ}_J{Vz\l8z:T|J̕㵍I*PrѲ~ p>C?OOt\=WB? b\uWmޫxZ`?}{O/^kOW;DߩPPjoA[1S͎k?w_r[%¡ʝE$?qcTz ts?V^W$I!-C6>lfMvԦ-1wBgSᅧ^HIP;"-`/PXDZh?9hJ&FUvM0xLZYԆrHyHCixIbdlv|?C?~?lCƒ -P@q?ʨZ)6CC3+IdϤM?.&蠔?·f pU v av ]P^???|n4vKv?rƕmx8?{ ^l?L?Ĝf=Ύ?}`^]4?8 eY?mNkfpDَ 7JC4=JnbdtMΑyI KWh]u `YTA,Vm<}$oǗ*A BE@SHl$NGǒQ? 𰲠W\ =AP?'lJ8?f?frT\fKHPS0`eltOE 1@?]糤 h$֘U'Z.vxr[Rd?yzzg"qr,"4 ]W?vKQfsEIfUX.w.hpF \JR,?bd dN|_Z7 H$""? a9L?F"vńgC?w#nx ¡?Gx-k9l?<5l؆ٌCD:sjx+?zB?? "8pR}Si8FSWlhE? ir ,  8 vR&R׿?gv*OGrE|s d*Z[eJes3pjډCK?r`n>iВ?I[ꝁo2=w0O遦\wX"ǶuuFWi ]W;s·8o׮ ~.Fr2T$?N ܑ??KtQ/?k?.nDTgtFOUǙ"WVb?]- {[@9-vxf-'ܗn8hoڀY)UC'4H?gw3g̺P?wğ{K5WeX?xSg>>^? fٿ..? Hu?hTf?҅ϸMߏ^]+U XXfZ>k[kq'ejO\7xi_އr{ݓ?ws/ݧ?pNYmEbP#ݢ?"?Ĕ\{Qz3qD}g|?o֫J?sӀe ?*(@βj?k4*pc fd??Mi~I1fikTg4ټCN>  wkq˦?B>kKZ NP _(Ԃ?ArVE%?2`x,)ă얇?Rzp)Uvԛm 6Dcq1d[y &tiokIBTDeI܊dqis\J]C*?]MdgDUUTjX(B$\ a!  Nqp{Qsuc ?H{{ĚlI?ȹ:ˑ?KwK7??ΡzE?ۀ3@?uiN wr+uA3٤S/n[,K$_0TtO0~\ ;;eoS7ުt6[bC-?򺙥?nйndt'|5O;Ps2fJ `w ?ǡe<7p=1{+9ܖ?}sĻ܅nq wbf Y0g]ց?*nX(D?vwUwh?5״_)Z?r/˚KEMZ[O;iC.|}RYcթ憚O~^3G[ϷV]8\}bKՎ?^K{UKCqsӡMin,jHC}+G[[ۮu]nsӦ^ ?ZA ?u?IvA hh(Ē +E7B$9PD<{?4 ?M# K.T?5޸rz#?Qt*$W8?utz ~E *fdU-[n~cD-RM6e?O?6-F6e\P?#h a5TY`z6]W?f?Uw F?kwlVx {Gp[W?rZ3?1 ? gYߍtEW@rqXGA;n^7*G?h&IxE*b|k*Moy t?LsQ`BfH 13X.H߻RDwWj<˸;HG?Zy?-̦LR-viGg\ iE֝6r=ϭ[^5n=:m۾?`Ob6,k ttI?iN\7$u,˖-ے/Y%|,K?H!JI?uϠ(?`E_{Z A5Jowm;RnZ??wNNIx坩·+/T NwWC`[u?گ =8m? cXˬk퓢uZBY?Wȕ7_,NS[>̉?DW:9OZdj?u}gzwXZ$/\N=&.z.WSyz :LrʛХNvA~'i n7`?+$@ JNj[YJ~Ђ y? #?@X x Hő~(n?Nce AE8D (Emh 6^zL R8` Ll 0dRLLD1b(LN?5l-[븽Vv|EsBKL\ =^pT GŊSQ???v$ќZdG8Պf%?,oI??V Spv83Lvy~fgcg'?$?~?ؓysocw[no[Y6wSz#On 5qE9R[ -?wxC3?o);g!D|ǮYdx&8[:ɍ膢CؾmPvROiV#??rG-R =h?4ZAR{{d8mEE[IG/mB䢲FrȬ?bաy6?ZM2C ^akax\`i.e{0rIJ ?>[M媓GޙN5> ? NkC8rvE?mWj:;?u:UWo-gǔ?u?]}m{6k(^S?+Җ~x􍧗ޫ?ŭVEe{VRv[բW]R+ 5?UhP?nxM^ۡ9?p?_?Vyÿ'C&CzWG ϼCa#hD X+-BrCD_c=OExg~cÂIx Ł<t!nzD‹`dlrVά?*wh= 9R ifHL(ao{H8.}(\NnJ `l@?#'?KbMqJr{C^__H_I,kuh\n [?-bh 6q??u30cXd$#x`>uDvOmUV+E?[?Z(%XYIBB?Er?vlp8x<܇?A ZҪi[iU?h43F_EJBj'#ё(U r!D?re'̥;h]c3BQEA?ɠH H?p.^7?wer᳴p"ˈ#q d"i?AQ}w˺vlht}NTAdݪ0fA??=H??b2,FrYIxpLA k-q?΄X.,?Ru?ڰ&lLm3wF:<\"I~@ϱz.p.tS?wp"v Ig_\;m`MÍ{fR?RR?*֯L棆LťVYo3CvnR0C?fc|@J:~?v ;lH?G7Cu?.6:  -Kտ; a& GNs7qSo~Ff???r m¥P+tYG濹l%z皦_1QnVm.Vf\Ryu?~uo_h h́)\MW@)k &U!W?TQ4{ATZ&q# e49s|sv$0?~ /Ԭ 2K@yЄ8CEi2˓Ob?p2XB44NFm?ꮀ YѶc A?_(/?jkEzά"V<i^2tS~gXh)qzͣô˜/'?~(3{Jy z?HN[n㫳K?|C`t_Xşt1c85tE? s6 "KڌvMHZLY$IKZ2\RA D"h%2 ?;=@@ԵOB5'YI?\PJ"# 7$hOfTy .:?(o^LI2?R# ʐQ|1z?ab? lYяm?)za0M8?i=aGy3]prE/ n`Ij4?v+,)V sï??s[ %TJ1kBt-?evXzW$V\eawS\8]^eiw7[%V?A Y?5Arb(l"^) ?B؇Lg|=n暣p@?u!ec (xm8J$r݉ZNvxizҝnA L?^X[d}J Ɇ/af?뾁g?ԜSZӹaNQAy Elجf ?S-| IEͤ`d`ƆEG?Iwq]~.?@??^?m׮7EPvKH?ْ־[ %Q$%QM)RCrH9Y9>CQNmz/E\`ܙv?BU~BqJLΐͲb[h?9ھ)z[pc?B]H*dA_j%r#adxJzSʯɱ p> O0e뙖.$2?*bF'$F?Y?K_&d]Rl`iCu?˒?s`#Zᆭb kR?xqb\OG^F??kns999U `R)fCo[?MɫlA KmնA,KWe uضqMm??jBwA?K%^y?ec8'x?a4R Fݵtua???aDҎXqAw>?x XE]!;ux_<=\k?E:L>9?,2Mq+Rw|[?VcLzm:7}S >χm(* ~T!EG?:s+ԦDYowQǷؤf,1gVD"GW??רbsz^?wqfNTĪ?hD#r?^e̗Rm՝?Ŏbh?>2;|9fc.+IO?8vG ct=*˕U2&+LnN{R?dYmg?'܏Ʀh1֧D灌?V?݁e *(/ tҗ::k R\~Hc;bE"rQcml3mo3 y %W=q?vI֕7$ ? Ne߸Zt3Ctx:rxW¨U=Y|?? A$OkSS4 L+2?TtiMTeRQxSt$;/І ٪%Ed6+`M?TvcS a}M_y ]hә@]JLGGd??'= |Hsaw7d;/mB<܉?e6X:d.8VHKaKj?Ɲ?uI?xC^dÝ 7~t9VZ?i343\B" c?Fld8y υ?D.lBBb,8R?My>]NC?Ih # D;B>S3??Q/uD%?dSP5NTyYu ?D܀z?o?L?> I"ULH/)?AJ PezsB?!b@e :մ!ekd$+#qdL~ cJMI)ڦ$n PjaQcEc8(zHf&hudfDb 6dJGABHY2fX9֋RyXD|=?cKykwLUcxzݳwœ|ST"TfjF+$8qGQMPhYhz}}} pI?<%XSyHR_ݺs~snOo?y8ǻG??։νdTjo_ܷ?n Q]eaأFgz?@?'KnMQ^N?Q_h/hx 4R}k1Wxg}uOzqCC}$3R^}wyΔ^@L@??ͅGŞ{j/l 9wgY27&??IY2,H"Z`5ti K_\l ܲTYOJjo,w[kPoåp|Qzje9l}$5m@bKm `jIb?ao>[ XDq5>A7yULE#8 Eی+ Kκ5ŃnZ rfRV?4fi9k?k{?gm?cXW3{pkŲoZMCxMxQE.n{Z߶ʓZU?+_[tjo?pţѹF+<ȸ:??klkZ=aޙ4B? 7-YB}w_?:7x7?Kq5r pͽs?GMuٌ^wä/TSsαdz? Eώd F҅ƫ*?: yϴUN~0zOB}yx#=k\x?csxA i^Ӆ7\+V?S6UQQߟ W2iG6jD?C?-Op`љpxajie?M?E7]W5]UUPT+ɔĹxe E%T\ťg`9glx\GB+??"![}ʇ֡n?YX@mK?h@, l IiqIM?ر?>$(/YdeADrHH)ʎm AG݇39ߐ?*+??di?aϻ1wF-t_?;3Yq; 3Uv!yAII|ܹN 0e?vcЅdx8oQ6uK[#y_Zcmɾ{?cJ?|z5:r#9~yяv 7 \ '?ΑSyf?f@`Ptxtt|?C{ Ўp8c`????b ,>Bl`x- 6ۙ[oa&7?i?ڧ_{i?gyk#:ՂrImNZYUXe??W?Ŝʅh?`f3Q)1jdԺ$T?S?\Q.8ʄ''\M~\#NO?ƹm+轔q?k bYSɁTOg=r14lzy lcZih)?BCu<4QmLԯr?s_us.m%FJ?q0S<Vr7n!]gs7Uef}F?|~l,7_k2?Izl?/fOcPBfe@?t4hާLBWHUb]g?Td w\^|ݩqzA`N \ M}i p<4Kl-瓝gceJ?"֝i€-'?w&yfіFўxs&Ad?Ŭu0UxVМ dлuKꚥ嚱?fvK1+';?Yl0??QT+jr ¼_e ?_m!̥$׈>(2Cz> ?qzpLGi?h?'@f?s?Q ypT}^lO39ʐya ?xLeŊ^9pM[dD2?XmoW"H6řQy?hBc˰3KZF5DFy[߇N䶸gbϩUyEJ`k2I ]lgaӃDt?{|CywuO,qۓ{,rZH%b[,(?4)Z?)LH?]fw#BeERB?j?WӵUPpɄϭF+Q?jx.Wh֎YMMb(FZV <2Uբ Q.NEbkPĂmFnzB;+}?>z ?Xyr~a/Nk?0֝1|Aa^ϣr7_O5sD.8?6d! # ^Ž®Sp|^4l1Z?'fļ ?;L??CU?}8w?s, &?& ; eg΂*OnYF,m` W{J֞{ssO C?]L<˄>_ŝdd??)dMOV.JVĒ?`kX7S$񄑈{?:?Y?Us-Gq2ZeuEZNIҙ?:IÒE?ry]+ۦ ,~nJ񄌮24!#N?G:FD0ymv6K+l~{ ?[1Q_A{q-ijBF aU{'OQ!_+wa?A06Fiy8?9X C։D_s??P`?B+㛾ފ`uoo\pu\u_ti\ {o S 2KFE8 ~]^z 1HN<=d7IF4uHo,5O Hj*ReAQʫQrY^VŜ*GVtWjVT?~??> JgR!?NMcHԐbJ ∃R%y@Hq@s?حi~y?zc.?ad2$R&|5ߍF[r??f k??DHd@V!]RŽsɭMfs?(mCti:vsͨO…KNvxxpP7v=T}sHcƥB.}PxZ\:emx^uxfB|9?J?8dWCbO*弗 rrr?[p'Z#Bn]fp_~*(LGm:fmB#Oiʫ߾}ox·{Өm[>`s/-lXMAogmD?oBO( r6b!?itPO/s_9?~uW=eg[񦘩iS? Me4ыJP$B(eZhj?J-4z?e@y˵CD?\?HwP?}nQl(7&:%&^ qۋ@LpyepuěMdu(Kn`x32!E$T{b|YpM—D??hoE80Zd{*{ט?_6fRlIӘ7`;%KfP/iWOOfj0U"|Ԝ?DܳK]Bh ~B jZZqmrd$by#}`痦?zg 7sT/M?Xj?l<ܟl>x֝RPZ*jN럌nZLNn̬jVS?jNչT?iXOYѸ,0GmiFyZtV>Gx@gfs [:1bKw7u^ɤ2n?mI@, 6!lM0`0 Iز-y?$Yt]u6 /?K??g|w3ߙs~'PA 烶 V?8j O޹s7C?}\[3 RyإBl@ȀZEV+|%x3vf5CibPPD eCX. (tXPԒ X׍zX-{jbz? hc̤ItD"B0DfDm{s:dz?ė؄B*s[n|#9z+Qs5gРh&!4w2fX+z?Tԫ?Kdf?&)nFqddWעflfm к{3wz߆Q?`?`h}_tMriBQ9"g{#SmLə{(MP6n~;u setvwCB\,?3ƚ]Lv% 幕Thb럻b/?4NvngioF[D˞ n*$h?ѝ`!cɌr???4{?1%2ihQn35zrr5Ml@|>m]3쬪DָAƊE?su?⁉O|bIz/?q[?%'CL'w׶슼]<_|8pn?wJ19>)'6ғ;ް{tu𢡊Lu:On廧BXNەR5~jW ??y&m2 Hm /Aػ&c/SrΊPG:G}c1\Uhvy+ʇN3/?ãcf %Jp7oW?R?\ ԤRI[|6bv< G??˺hJP?b lA  lg1?C~.̲ 3y\h%I! )sm4.p6-CVWCdEK )2b:hcv"ev|ނ ??.K3f Zc?C&t1?om?[ ;}?9>k=LD 3 -?h}hԷHO&tIG ֔e%?*z1в=}u5fPhnSte?F/??ڑI[n>5]=Jᘭ{elNTJg讳6??C^JnITӎgb/Ɯk]0cc?  tKB@Hhnh4#ͥ m+y?}Kjߗq \sY̥4!hG!?s6f;?~﷈c5p?|sQdM^?RʪQ? }_gppAݲxy6եg?ضlf@g#+cA .)lD"S|iә +s"K1fKtdF=]|fKMw[M8 ?Z W cO~6fv:^b&Ҍ~EwASp܉k~ނ1Xօl]t?a â 6T}ƍ4"?+?іOmpkk1]1&nwNE{^?}DM>&(ߺtEUZ D/Ӛ]iX??g?뤠y`?D.FYS Y4\1ac?p2aV?QCNz??Y!ID?HiQeIl/0Q73 ?`ȧlZA /{ְg@ddasLXVKJ"d (ElפNyz# ?C6xP?EpF7V?:?HjU@X?\ց:?oIDMBYܜMyTTTbkoz;E\Xng ?w59?A9H ?r]RvJ<@.^HF?ˇ̞ͅTy{5?yf1VZc7NΟ?yD-'-s=WH?~0]ݵЋV?I|wvpSF !;{Is??J? Zt&VsŃɖ?޻r?nݽt?^Gf|t!ƖJ|Uj'_r1AhqXy9o\<2]e}{?53S(WTB|I1mF YoNkZE99MY6{z ?[Rә8L? {O;u_\FĄ8?V^x]Ep?l}~fY6 vDC {=|KUZkMt]-ʏ.T]˲w1?4ݗD{h3,͐K$aQX"%t̀jXeI?U@\LL q\HExM?Ħ,Q?C2HBQuYљ q1c0bsɼZTEN%? evz?6q-4r#!CO9VZ&Nc ~?əx~D`8hO-q rJ7!_򽟟~~;f?)?_GɥIѓJma{'YI2R/?dsu<ׅ?}Ls+k]%٧ëso/`{?voc- xES،L!2@ ucCBwbH7͓bL(?x1ѝt]aS2ubF]\lO[ȂJ?Z^FH[T+ZWb^QFo`qPtB?af]4a~{v?%/٪Żv?oRkc?`?`/>?F :@DҠc4ͥcnIذf7_![?Wt: NQL bqf7+1i?R"_2oqL?6a,Hkqi_xp b,{?|,B4w$slP(?% ?_Epe:?&GBDDT9V޲o&[)k] rN}*ߤ~ξq[퍵?~wxW8>g߼+?&ʴQ@\b?hiJB[#|wOz$l`I+]!ng?a?8pݳWrmHurݖFZCxxC )xا?_U[%Isagh3X l{??sb?8E3uFU*ϫe\aoBO ?xtI xkfb]I2qi?IdbWw#cO00ƫE?uv?d??=c}Ϊ˛Ͽ |k^/?Ȅi??y=_w./R &?G)W\?5UT@vǘŇ{K KsХjfB?tv?)WeC_ ?tZ#ӉۈvfLxyp=YE+cޭ]A&"<FD QӁ?ѥ`+;y;m@j*?JfS۽D\?IJ^_}4ڼd#nʷŢnq_CxdimZX@=dHov$?h_W|}kaUnkƩ?& ݮ{IP?jok~ysJ BV>p'V|??WlCbJ$m0hЕAkb kqFk)?S-aF?i SQoH W@lD[`d?DOQPy 2 bI[l͕jj{urF,,*9P?n?-?Vpp!H~m'|N6gR\?ܓt0 Hݖ0OLo-']ۀ%`go`?@uS?:ӪגYCHᘉycWх]C??W(pD: R!ZÍ{[N?qT?`YܵAGIܗS⸕blPĘ,?)2$BD@ W$YpT瀫u?ΝyE]?0vT@W>-f+2Ic?ΆXp!ɼgƚM{S|Յk?R@9N?;\:xta\?)iphk7۟N_3}`vO*1~ ;U]1{yu?+ԗ+ݴWTRyl{|(^#?mt^5%Y?z 4J\17]m(TQpfİհ}ٳ?ʝ?WH??SCJN*{8R?e?Tۛëqm{x97Zo^ҋO?ݕSϬ /HWi~}ZIxnbp$^ԺYSvY(d?we՗F?$;`AuGWqvyٴ1T} O}<8[*Ӈhm?:3S1KG?է?\? m\Ha/ p닍KƹG fU|%N~PhϽ?PNq ˖ݒE?Zlɒ"Y YIjeHQ}_?%يhc{jSPE͂?\NemIP`(V_ϫZP EGII?5oKKpdW*ӕ&`b},?rYlbFA \m:?`+yȭ)0?D<*<ǥepR]\{r֖Bnr}4eWٌ xBTU6v,J%)&1C>v}ߘ',ɶO=X.FGY2Lb~.Bvu|v1 &rv&5h>_}??G룗?KjQ?' ? NnWxu^EcT.pA,oO'螛lʚ|>y]@&rK̪9m>؞@"|7j?7Ł}I<(B BKWF9)?9(SԔZiM%\4?tF@\|Us2i"ayXh]s j 䚖5?/ZۿBc)__X%4ܟQ*ۜഌTb e^pZ?cLt bfr.SH|Bh;B1".hڽxlq)(R ^F]|P,T!eTU*]t¨VFURenW1H-} ,]?Ҿ.F}~/ ,V=hhr1Rw^9_M fW?x7וoJٲ?1pِymW&Hh?z*w!,?QHjz=DME??WMtɠsB/=fmW|sRfY?z&l:yv_?sG"D~:—k8{?O?/_|CdMē{C:6ˡKpؒ?SJaCrOf<ÐNYĊ@;bFx?$Hn ǤWY9㑃n.?b;S )Q- ?0Tԣ) ?k]&} kAb hxj?b z܄ \C BX/Durg<ҀC|?7>?u?l?М4}67}ȥvz?l?#Vjja6]Ί_w _Atħ?T if[EoEHnE?O|S9s\?'Dg,8"1o~q^ ?O{}ᧉ?lLU?w+re?pk<?in}{#vn?)sD?bEt⣽tYUuo?q`Vbm?~ʣg? ,vhO \,3tʟ]l+~߽Qe?9£̿uT?O׊ (~wD\?F"`AXni 4Q-? 'ctR@,{Qɼc !n"9?BxБ (#LY蘰Xh7ѥ>ACvm ?0d)TyPeLv'fMEl\Lj6R+9x‰8R։d??-??x?:Yyny?n,Źd{{OTGL߅hx.^oLݰ X!7aJ:h_zݪmp?y~[tSx?ז]ζ?@,hQD|Ksz? =BH`XS΢) "*׉& >6ڞAq'+%BkVJcd?來:?? <8gS?.dB6`Fty?eg8I{ozxVڠxC?%E+˟Bkp͠I?БJGE%6Gؼӈ?s?J/cPdEv'KJhVN햸W?_)#$ ErydrTʐG eb_( Zt?S?oV?j/ɑh.@t]P{(xy(U{X|p~hI?8Yjikl Ā g6VzTM?RuCѧ|?-NOYWWjp#]jO2r}W†F݃2?LicjzTI}Aczrs}s?ڏ{߿z7{V9VS?eV?c OY? vfJFU_ʽƅeXbkw-@Ot'?ީ%ǮZ%??u3kǮ?`3ޡl]UI+b{ИNPeRZfiY<$nm?U@aY2 a3]?M?v?u?e=#@W"+*|1K{T_C|Cg\Ӕ?HSs>NGEM??Fy0w9șERB7$Bo TlC ~r3>Y@ήwy2'(H"pv?&L`?LDƩ[6"S ""%ɿL\?Vt6ۓpu|XN =^?^lΐ3~OF;Ҩh:P1@5@Y?’B`?@`d??NŎM'^ھ?q?oUߨyu@ZM>}k?go 17e@OEO%)L?rGhfɯ_O&nlu4R;?޴}S?iA/tˠ5|~B?qv8?[Mfv8ylǖz Id ,[IJϫvոCm ]?.Yi?tދI5:-LB?7ډV9n?pŕcު_˾3)d18o?}jلt֦ucWhKn|#:Of {'I\u s?r7!4,?j?ZLKLQr`YdyTdBCsh 3 gi w8x?3IBIȗYK#R̯۝?yɭތ%vyPv@w_E?7q3im@]ڤ9x,,L gV$!~~ !(?Lj|[:8'ACNw 4:s;aӏx?TRZ VKIoQ}.Kn\JIU rFJ."q @$Ť$dlD????yUkhبtHG{LLR]sxY?zXdPug7-ZN-9r$ jJaP8(GPKaP,jGePTlkViE^:LQw.uRUX*he}B%IXֳeSP*V?9:AB)QcH5d˂N& It6WHlG[˃?w#A ji0F ?.rXKdVeƑ=:Ge"bXLSb`uJ"TNVsNkae9Ϋ?f?Q4U~[Z z]!괮|Y+J?U\y뻿@ ʲEPts9I&6:?L7y )xw?pxu's( zۦpk}m + "K?=ڰug-lv}i?ap1Ymo LԓJKf\YITJ|1a?/nh7)?Knu?bAMt?5Ad(/ mؘ\$GiڝB3\{Q??v=A3̴ո^j{tm-Qsiզ,6[zՙ_?q@گ?ZN@O9?۪v=F?ir7=$\?|?T?ƍJy.?KY(E!w?}sNp#9q6R`dhe*O_Lj?zv:ŸpJkx?R??uZi]UIR+ ,>DP?Z= қH"E .??Ad5HkE?k+oba]ǚlj1!l\??KoDwf C֟LĞ]K:2ACɄ@?C>O㐏_;;}};dž?rᛡ~$?zhIp!xTcLVɜ+G);??ǟFiA;i[f|mRYoM$E*yUBˈFe?g@ƇёF?fy O< c 2Q73vѽ=?s~??@_q)Î[Ȏc8eՉ%˲$+Rt-,^")Hj嵻\}syHl)u>4EQK9} aa 0̝TՈo*um(9Jdykxu??bBq|APv tr?dfMu1?gC8Y?q?TQ{f f?-!)yZrGȗ$˓[!?=C?jAL)xۈKrX?LF8jq B?5+SF?jV i_EP\pwZ:&.z6r? J*tA@)[ 1x??cʫo*[Dxml˕f5 ۯ-uKDL+V̳?w+o*vDXvq?od:SK殄}ȅ#ζNr^la,푥~5 6V4hnOa{+p3)‚Ō_E2^˰O|bh>mHQ:3 ?]ݿ©L͜ء޻ڃH??~? _kD9F]X53GXe,+}$8C؀[BS)DN ?;x(0?U+?N}LҎGSѮ P?t;$8x?u7}2=ux?2??/ dfU DUB"#h[ӌ a?"CsZh eP J|x??Q-5SC?-a5Yg9i}mXppY #,??smE4(0r⏏?cdX-hoEF]\хxdG OӲ^ %V(ag ?c%xx?o;?ہX^еQZ`UWWb;u-[Ԕ{)?MtXR}Z $NE Mt^i0Qi-5fO3wՂ?_K`*?r?Gk9nZ~Jr#$\dtX@&'Cn㝲DlFa?8臽?a'Qm5'"E\E?$B ?\?QkEƒ,?eEsLj᳼Fafkim֪G[JUc jO~wl ]z?HWy?i˧IWߺkۉ D}X ?,]ص_?{sH,+}z}g/_TWLwL־oz鋇U?l` ^=0?[X8L˱%:v ZmמAG?ԭ𣔽%!Ue?m1a@-:H[m?i?sNĶ|Ȗl˖eٖ|(QH[$S?]sзeiT×?G?Ŧc+ cѽXc` PQGOz3HFZz?GW~;|??~ U|.O⁸LJ"TtO?`OܕZaPKgRO{N=?~w?U3L`~&#&nur|qCe/3Sq?QUM5znV!s"?X!A/sd;o\ O ą? s@݉Q['?iZXk& 2%AwÂ֟$iWs]?hN4_[쏏kL|o=X@6f^mjGZ1߈VҌFhtk?QfGPctm͇~{1I,iznZRP٘K&)h~8=]n ?s#}!9asщTA!@~?3e?ɂ΁D*^xphyYZYpw 17GQnz?y?k ??a$VejݐL]j}?բjU6??~\Os??+'%xƎlŠx~) OŮ3y6D?L6i_=?gd:%Cu!&nV BP|a'y1aYOOFE\@ hBDCTH'TPyLH{lF?,@U?5pՊ?L`Tઅ\UPΖn?|.]աuqKU)炪T|-8 5&o#XX+|[@%/H?9{fh{ ?C??݋?FV?yz!Xͭ`[ֳu^-hXa\UgZqgg6>Kx \dp?SNI$?ykЫ?Ȝh sN8Kl?a^_? ?'3 z% \?j?3y)7_T0|6zI|Ƿ=x}ZoGT 7?%WĂ֪k?lt$]`Gl? -ih kY?d\r?|1SE ( PuST9(s^;<9uꌧTwz|@ynGtPʜ÷r *,_UV0Ry|*RܡSVF@?[D?Uz-ODyS-M?36q1~uxf} ZvD?fv ָK~z$^_-h[٩EYvPz`fWFe$KgCrvK1.?U:um n_]쥏Zίin_xA\B?T*yzof?C/iz?Nm3TGUg0^{ev;` ?GkՒ?>*S(7t]x/ ?jM?Id&Gޠdy^tcيYQ?g9?$A?XzQ4??QCwomU9D$8񥣻Ʃ|$Ư b;HVp? tH4?Q!i# y&?xҟhp?^d AH6`?4hv* ?eFD\AswGI Bq9?W䑱p@Is[ Du H{໻_Yjۣoǘy(?xBvβهW~fO7?m"?{"lsOALK?RJSǼ آ#l C1lz XdPCH\+xI8Ơuҭe4!OST*Kg9&$W T8ͱ4X6qAx?/Zsф%En ćbgXl! tP{ Tu@qM?g6^C32Vu1~}ݸ֣[?m!1ؙ',ĶtQ7KdΜ%:q͓̔es/MYOX79rTy/?Ba\jGĊk$dϒq?2`\!^Hޭxi{ }WBzEȤ6Ki {yIѽގ EsKs?({gq2ld#-=JbG-lH |笽G~#~WuƘq]IJ@qs,??Fʮ{H^e?XԚ?}7dpd68ַs|6- BL?|M;HXK?6IgFlBp.ɫj#[=WBDa1qqE|l;_~>fz?)3T g~2$FMحheIZёܣZ^lM?o?J,=џ>r?` L|??Pٸ$cjm0A?G}?ѵXr?ԏviiʕ \5=v\ʽϜTHD ZHTԍZ4{lvʊfm_oucsJQnH[Q=c?M T%YԀ??WZn"ᥘ0l桔d~r.4 ጶ#:tjm\\{:?)~9EX`<hu?4m3m,?z4t'&.%?cDPCD|u(H|AYd|f!CxQN=I'?5?f??,L???ϧ $?06?@5# ?Uo}?Z?aDI:?Y^_׺#H3!zY2a.I~݂&~?Bw{vo ?$he԰?RLLnًH9 ?XT%dcF]..a)fq?rD7 XL)pJ6_? d¦e.,om%ׄWfi3̖\h*Tc8zF?0 6av:}j??ttݴ?d,?MK M}0`}ߒlYaɒlٖdCm2}?E_?W?ߌfDѠJ?)*?/C[lsqieaE?$?0VnԝxCX7RJ? +=POq;4W?"?4FN@c>mC  ҵB~ujMNvCk`H?@L~fH4,}7%6k&XO?_?2/sArWoOAJR Q/$nd=n؃U|_yɈMjwd̕ d\+V/vsAg6Azvb3`hMP%̐^9{+@"]y|???I$YQb gG4/n*jKN6V/f5Qs_R[?yNܧ2{L?њt=Cb$B0?t-f?`?)1ި0DqOtÉIi֟]8eH/u" jk,O\ef?>r)jq?Ol=HjB@LEeŽlA2T^ ?+![Mq}D}veQ\S ٛSwx f6zjqM?w_YZ]J]\kim?w BkT7מ4]@o_Cm[)EGrzt[vǑ BXZBgD?Ck~6 x-?EL?Ӛ#.bh|: S0a? ?Zܵ.hۄ4\X@~&zEiy8?? gz9mPn ? f`w]Gy?'УG}9:(˗Q]<4v9*?Yx  a!Kh- Ʌ~AV~ EK󤘦㹽?>DP,\V*d.J eD?$?hp-#`gҮƴӰ4|?dL`$ku1^N,Մ~O'z뱨)S's>\mMuԳfaCFT:ɥ:$b6Ͳ|CqJDp?˞ ?;E y^ ]e?[?b!W("\? ]^U@`p.SMBd?p 4DQvyYϗ,Af\BK2P ?V[*g+wZCX)*iRypK݃?rV͟oBX?&?(4 uWU0h??A_ u3s}?Ozx-=Yۅ;wrZqjƹU s[]X*E!Y??S{Uxi|}u#f?/"TM6/jo&QB[տ0{%?+WUL>?0cw*G?)wFvFS.? Sw_̶HR7;qtfzrW= =w^_w|?Xue[1#?CEx|IHARU?qU L1?^J,m}>ol(g"Η]- %csʊu੨ݣmD`ܒ F?@?Ľ).|b.?gvrI:Du <ʀ%owkcC5j[UߩF:OWY?WsH0V?&< MICM좞09 8ϦYypvH?_%NrecuUKMV !A.dKxEy?5朗E:̿鮷&??}i?]ZJV?m(, K?@.HB?v;_bǎoc{<!$RJqxC;3HG?H O QtĥJPᄜ[O:::f` F`y"?- ˂V|QZ)(3Z?OS?pmX&[m#w%|rz f?p՝?neqq е?wek=֑tDJMm?T:\})[Cꃨ')v.,F0]<9t7z1 VX$"?`ӂS/ lGIXfzKEsEgk 8it)?Vs?sѹf|s'ymdt5L"vhWl?;?ZflEm pMp\ U蹓D?g C;?`3LO}4ڞR nh!,?Cäc~o@+# -OmR)hv%Vq.|~iquPukby3?z#~J"@Zbs$ 9D1GmvGsuFܣ%_5^ցqD'x ͭtӽv.0?1ƥsE<?4]7`N>?eBA*D??? `iT2ɴZ?|I.U:iͣ" OdEX^Ȁ-UG)SWݖu!ibK$C jT+`^ p! ,R=uMC?JP՜8q۪Rvj-VjǦ?sN ?ZW?5J՝|qX?$?aw,Vj3UoKJ5nT( ֶUDZ]*Wjr5߈GPj?Rh s(pHNb `T*(F7 aM:)??̃ 㨰FQ%٬ad %EHg?>" cBpMl??Zk'iӵȪ? е|H>?3uQ?kvQp ??4D [\zP$8SNYː???{˽\A8?CֳK^f?!"gL3Hu?"T?KPڻzWo?~77~I$Ÿ.2STlxB?謥?"?8F~{rəK?gV?o 2`%Z[嗆{'o~>oo!ΞH? NRT/[Jv[ql'u?5 YccNBs $N$!{͌F?tK?yS^oT}ן~SW~uyyZ. z:әu /D~?^gwn稼W?gjd}䒽JT@קkw驇ԺCi?{p~?d6~cK& f1( gֆ.dXUss'[6nxI?V}S<|t %\?~sٴs[{W>҉j9xfCq\?jK?YE}Hsg_\Q?L?ˬ?Ի~U(NR:X䟤Ttp.qOo 8VQRD0?Bi!\ R^nO"?S"OGDԟ򺨩m`?ޟt,p۟ ۫Dw0yy hlEۣ_nMD{N@a!nfºt H/vϽB_ $*?)D`G&`$? PqTBI-]ٔ|=%?S!n gk"xBM gM٭1xgBFALIY?P ꎂ:LI|aj$xZ.9 мhyax43[$26R&Bd`LhBGc@$fġM$aeŀy` _jʆ tI Ч\ u{ yQEFБm.s3CRTfTP"?(k{v?R=TCmt_GeTǬt_xSUsfhq2U ?Cq \?&ʉ^x~|v @cXUޑJP&pCBkB>Es|?zeOѠ%OKhClY4?L J?:ӋecMElXx?ȨP{!8@Iyr -?#En֦5/I?p2t%_ՈIΟ?ػMQdng(@0?%R1Q$e!!R|ޯAeF27,c SQ7ZvkT{熎akw ӤoD9"ejm|Kj4qE?nΞYtfc "i_V?T!M~wWm?{qvETfK?nk6o?zqVwɳ?ǛrRK_nٳڷr1;Η| s}Kxy??G-GGDνX?nj)Q [oC:j̷F>Y^p?9jZ^R?/gde8_۪e?mR{e[lG>Ҵ~f0 $>Vk"S@y>VX[Cks2 D:bj|ﻦt֋|FHևJ) \-:?el&P?wpTr.Njܨ?tF ˟?ԤQ T ?g#G?k?מs^E=MPE ^kjrm\ s A < ?F,n?æĽr p  P *?WDNl?p%dMނO+d?p58g䵸赥T=pw@IR/j'?ס?Sm>"G 4.zEK~N 儑YiF ƏaL?ЬMExg0 4BH 'HUQHDТz_RHK?' ?Hx OD? AiLr XDlC?KAHJ^^!?ڵG?ͦ[z~59G|0sEZf?IYX?2}r?ϺT KAR ~1!:4fi?d6R?ӕW[?/_]Ȕĕ9?D /六RPY?]%ʹ@6pܳg?.^ ?'|?|<iN@5%ULF8ϬPU?Bh |duҋKZ??}vvyxc?4M&)???{ Kcdױ?wxDD?|]tu@ A?yPMTWZFkGZٗ?,nf?rБa|oC2nQ!?\L7ʋja K"f c{| YE 텕A8b%A7YHJ8$ LQ@T@G8o{:Nu4Hb?5ih-R]r]?l?dդK,ӨLݬm xHTM' DJf?Oe?ӕ5ˏvWgQPDB[f{{~?Cr-UwyD:Rt֚m-?ni~U?Z#w][-~n4tiJ )j&2iԖ̲ۤTkn4sh4SUwj󶒤V*[#8jnԜum3CWɬ  CX{El *?*VrL b%?N6iAuR@y LIXecx ' *ʐ,ՒRJ?Ƞ E a?P?jzmRkns_nE?EtV ZkF?֙U\CQ d&._pfŁpԔâ8?y/Fi96Isq Gugߟ8gËHUeH?|l/Gν75xɛvuJURX@?nh[5_pL6WzNٗz\?~tڶa?ԡ!qRz 23q;Ch̍,6WN ?im:~!\TO/; {J֒???AílJG¦Hؘ%s"?!7i2a'XclO鎄3ЗwMaxfZמX,̏n %?~C \HÐ?P??K-)CE j?`fcm4?c%Q A8:Ʋg N|Yt-C&,7U?HY_o??3?gmxn pfJYM|N#VmDT?0!?ρhz?¥?^/^IjcF0:X/6RN pI."s#i.%XmjHPUJh_m8? h ɚMS$H6m'N;v?S;J|ɖeYaY˺I?EI$˷ݮތJ{QŃ?Hc \y6 \5-.ѱ9,d\WMD_t1d wv\'BžZ&$a[ xJT'/#K,-DV+j|?q???u_? ??t?@Qn^Q *-iTX?XK;[?Ɣ{ס .;>ZH?r? `jtHf O??]ag= 4$~=yRD݂?Ћ-47ŕvP*bKtNNw"PSBL@)QD?HѸ-<`̚?msk&ʦij+{RwgZn[r/6^aL@ja :oQ_ILAJ C-q]ٜ_ @4 Q`* v\Ly 4%[?sZvkN,JR>? \h'Kdkԟ?e ?> ϒ:Љ,_s9?{ ݊N%OZSy?^Q?m灑ؕcENK@Lk"s"/HDsg ?dfB ɽ4]?ĠEX7vϖ[Qռ%!s1nHړ?4r4|1h NP { s AHCf ӎ" c*ۚZr? Sc <%[Nk>% dZTNu{У IF#F^2eǃzt^w<:-PԙIi?pXBO> [?"+s d}3K6?i }툢Q>b ?_(;u?/J5 KrtBi],?kj3򚲬kRQ6vZu 뿬??HZ?禳Œʜ(Iom\?\ F?w,+>zСCfM?yy^JGҞi= YzШ,a&F?esNhBzԧCVZ&KiQ`X҉AYļt?;SDGrl؂\4^:83Xe!UFBQ,Hbm, ?jj\etҵN}Z6[su~?Z|Sa ?W{VzW!k2Ƃ.}S酔;hW D 1d < ?tF"ߖ0A2?[]@"3/W߮?Пm"?Nb۸}EQ$@Q?$@;@m$뺎alkR,K?Q?BQ?upr?)[c;v@OEKgS~ ޼ ?gKww?jn?' t?]Yܭ`Mn`.lt% h@T܊PYɤ?t? ['Qc+vXIm- np ]tUV*iP9MrG?Fȶ&Yau?5*MYx~?q ͠1Ip$$J@I? ǯLY{Г o@?|Ik\N [@?f9A3A6 hD?)0??KQa?Kk8:YzW0j )Lc?Ċ? Z޸Ib^,KD?0jS=X?\xwWw4?=M+&Nf;.Ke  is"Cu9R4##]Œ\LO~2r`p?bAHpTH?pGv?9Ym"]O?nW-U?7 YټCX o9LHF K6:w TH>-Z=h`ev&V`{?yFx oIYVmᗑޓ{vf:U?:}yagyQm }j_?@{.p޼})?bbrk Acw?AdC(|%UJNμ_K®M3Զԋi:} Y?n?Ciܭ]Sn|则~:|| ?24E\xgGͣHr V?t`Hͷe'H }̳pP6TbѠʂJk#5RZfN:D?%+!칒FuFhB4?6 fynJMT&&br[ 锝6cO0[?M*ZΛ w^?e?VT?b7P? 14^N T Ng9݉?ΐBF?z۷?FڷeUYn a. 1`?H4D!6? 老aLYq/Q ?JQ r1'?|FG }.:nnӏ׎{ֻ[N ?ˍU>%Ci+UbCuar ըy_V3g-Q+MuK? )갃| ?gR02WdU2WWTUzYKJFyg#GxY]YWǴ\ZQCs?I<#cޓLY\Ftep7X^O?xFX,cٌ`s"DnI\EMERC-0R? )T?(\UiImH; $ YVkת-u+Qev U׵jZkRx{?hkenf#:?O_}m*iLD !d1c'P~A?|4y棉KGuA *+1 :G^4]Ա_<(eEO}v:?Hg~s~wOXvod?UTvΪvK޼~ c/ж|>$Iy|`|ޡkj`ix&j?..gf֦?`ft?2ۚuWNp?>]͸yMrF9hq2I/N:e"ń)ӺU tQ 1[?͌$驜Kরlo9PD?U#DE:?4?Ӹ/,`qҨ| d%i߽zKnt9ӌdLI| `ЈzPXZg @u4UC^ oN5@+9giUih)+qnHrh`?LXx?GC i+_H;BEƖ Z?&[/2j-'VEzlUZ9Vh,09.\B% ( ^QjiO+Gbgir5Jx>V?G–!zNrJ`5ʤ?4іn?zt@KJ{zˠ[LmqziOz$Zetm>A B?JP???BgL\ȺRʄkڊۇ߾s|V?w_W LJ\Kډr C?.\ {!i_%;~Шp4O{Vnyzr3Un kjtב+v1*DrE\`u*1!JjEI]b/}OrZf sŔ{?wNz$:^YTnxKP tc16 Tjp2y|˩Wh\xxa6˻n#V>a([@??r=7{!>r'n:8Սйhԭ`m _gdĠAf?>]?6㋨MCQ1g NG?>?R+ pTIȜ]ϱ?'N?Z*>l9o{D{?ڢS]YAaWfFѠDC Q3?[ϯnt Ѐ>S]ረF@EYq8d"esv{[79C1c$;DR}D KO?'UևGoKTsi`ԗǠEK&|?`ɺgqՀ:ҳE|uOťMGB`e* : n"9;M?bذl-?^eaטxm| ek-[eɖ%G͌44s|`lڇTUyH𒪤~Z&2eM?!e?qb?5Zk&UWsBUUjq5T?Q]uu??NWe?h]mKlu?=e^UL!\~lmkuM[#D \46`?z???EvZGc$G!d~5QM2磥?G^Ƃ)iS#-O; qTQY]mu.B?< .tz}00cwbuJ {G UJKRq1??X! -?R>AjiʖFLĒ meLYO,t T fӱb?o7p6f\cApfQg& pu!RtqwZ+,M 3>b!??3 BNa 2w_<_b?DD?ߏ05| gq?CFR?[{sᅤO 1³?Oa3=A9̓ت2f\Z*+T`e# SKGHPAU ZnкHq---9`?GbRZʭV`?nEc?]?]k?Im,+7l\{K?X\+UPho Ib>[I|Aq훀/U fw?С_z|!POQdcM *ϕsQ*B/QgS?{:qO&V”/s - ɍ"`:2laIc[ /G@u4H<? ?doк@(Z:1A5?KRh˥J4\ R Ful78]hpA?bhGcA?\S~|ujjG>ޔi: Tl͑|c38YIRq cqçN_k32L9[bRy?4cqle(lM6i #1!\0K:?kO,/=? 9?G*+nH[EƄ[ۮWXrwŝ{{{Vbs@;b}+S{[?F:JʗqH?{zm˨}7hˬ/a!]_/<]cWvs)?NӉ Mٟ7bryOdV)^*ƥodb?ROZ ?[zy?k_7q!rr6N3WTO]}PYMsqcvzK뼯[خۆa^C-O.ΑKGGT$Jv~{Gj)6}6`J\EJEWab'=]xOj6=bVVJ9 ; ?s%դPs Nw"qCɡS(4O Z? r)_R>[@?GyV00?ӌ LG HgVPУ&q3??ͫ\ ?=d_?ǍÝNCIvguQ_ QRR6U쌛ÛJ'mmrZ`?SWm[V%?"=^8r{y-h6< . zEX?qѣ@?׊e7 fpȃ!6N?L}60 ~mι.77?Q??k*lg$e8?>䴓8&WO:}O?}m),޾.? ?̓???JQ| XYzd&& &q;%iC?r3=#N9"o#ñ?ig{@=FYLO?K^˺RIe}f ?~6n$4Fn*cXhD5wC JGW?AՃ,hm^2???hޝ%Wh$dJ#?*eN_rLCI*S6v{<ƞƞ7lcc?0bAHBHhmInj??[@|u*Ü$R5Uzw^1? XPY J&?MJ! ?g+֦/?[GZ[ oЕʊ[[m. a?9Nᮔ@ ʎg+Afs\^Db݅+v!(8?smSL  ŅFi=g~H:IȘY̚ ڕmiEj<9HVŃAaOIn?yuM_U~M`W?$1Oa9nC)??vJ;{ JEpN1,W?lSeCcq"f#?^"~Fo 5"\mY4Q}Qu?GjB{?P?>&Ssޞ*Gih?0?ቾDs`?:p?bg[1ujk:0}jX]Xgi?m3q贈Fw#[?~qҿ?]ǟzsi?kӎ?o\ Y!Vswq?İyɎL]QWE/ 6KaC? 84LMU?> T?mІ< )Ӽ%hdu_Zu M)l -jHC?9Z ?p'Ä3\*KP {dkH\: ÒqUGgVF"ۙR\}W<,A?у͕vvKQMwxb?lTa1tB kݦ [z?}tYB ՑyisivC=[귚suγkힾF}e4RrSڦ?!Yg١) [NrN%Ȉ?g?*F]@~_]@sרX??֛g'L?OSsIIs!B$"_][nR6st6WVUQYo}꿀/([0A֟9,ONJ`_qRSampl?=heW' k[쯚K/F8Z`??ޞڸ }1/}?ivc'M? ?`M &6? ?BBB?]{v/y}i_z$7}3ߜ9{>g!;>q켥#6z/*`˶c iIUy?VldsMϑk^`O4`=ϰC/(h9" vtDrؿicӴ|QWzWAd.3ZdWQ峹L uX?yӓ^Mne+:׉]\EǻK7f͝#ryML}'cо/%ɀJ#yLw߭H?]IP1n6{?`Ϭ9j!Fϣf~S ցZպJ} { {o>EK>3nqe>+\ݜHQi??HDr{݇ F ~-WԀ-u?C?V;QKUs ?\p`뺜˕Ogd`?+?BMՋo TxKSseU. ??I.wSҰzY,:\t5_Tz6[PTєtIJs8ЙR6&9`^'?sv&AVd˥\lane@?aB Ct&)HT6z,a*Ƭ?MW}a9%UdpX|'Gg ^SD jeӲqqq [;;jq}+Lq%CYtUž=B [HCU;;{;*hyb]V׷TR[^!j?{]f/$m CΩL3):&IL`?N<瞑s6}K7C@CZm\ U#VX?UtR?3?]9xUϻ}𥢳J;jAx }~jofV[ޯ9?M?SּY^)p.e}\0jSUvMuvAN?|{r~nrssn ?v?MUxa\`[zg[_oIʿWh:vr t?_WlHi:T,LY$si!???NA*r?ʤi N3l?b$p K?H&\n՟\>TO?d,U|4nz\r(h,$ VeZtF?aPI7٩@cGntr<M@ 0D-jk{?U?d&C5&|P:\Mt_7VE6Ďil8.{#Z 8C Uk Ĭl?2¼3J? ?e|)$m҈e)*Fo9Sݽ-#W,#u6?q 1 t^V-p1 jmm?7slDr?O"&?C*2NrI3Z ǔј`nFPn?T3 eaxŦ?!^_`\P70 |PGw?UaLx=?Pi_?QjP9? @?`s}?y^xTi xƗ?@ר?qy4jGrhYᘑr.Iy['s&^I1v9bH1M~ft}xȲ?SRs 9fD:r"uəL>IO\矹"j At]p?X/DO՞?LQINo1MXӋ^uö~^Ẹ5p5K veG\k`_?QS*M?s?!Dd<wg>_hV,޳FN{?kw |@/0:??w,WXYd f?nl?MHńY?4X PRWi,̭Ԑza\/$=_Lm |u5`c |>@IUXv2[ɓΞy(bzNuo|MT?`?i[EOBR⮠y/`G?Ĥwj?p:~k?OV[c4-d((pxOŮ!?ښnj{U|5hf[rqtQ?4+H?iFBH?#.B?XbXĖ'9/pH_Ǝcq?J?ti1.ċ&w ?GOnYg?۪7^_/B?o<5|ugD(38H|IJX|^uqgQ.\ڭu?)}|j-H4 /?Z/^dNE"lrkp S:rw3T&K)~ ?#]??I$Y_|??f A>ZyNMݣaԝ3ۙa1"Q!_tux?`ohUʞ?i^?nXzsu'7>wUW?K_'U olur?on=/?G˯?*?[] =^W\?HXaJ܅ƃ2Anda=:EB*8B|ՠ:Q˴O?G??Y41.?Y/3υZ|1UuvI c\6ȉ:oAw?םQbyWΆL&3 ѝt(J%u" ŢpBecls?ha6gô4E !F(<ڠ( F?Ė?"p}\Oe\a?piE5l^BzݚցmpLJ!en^fWtVXvCCC@Fח}*>( aD}su?j?7?=02?KnTX?SyFξH{7:?ۜ~? <cW F@h?^?4Gkڱ??းd:x?[ d\_oTBwߚeuߛ%?=E+x.h^7_\q^7r4?i{k A? 7IF#"G?WŒcaF?C3IqRM3 :ST?760qc?.ف7oǰa7ރzT fci `(3?Q3c r|?}Sv8S8ڇxGps?ltym?$m 4O~6?mDGf?jvE4. d <+AA MP:Rmo??C^jSIJf%V5yby]}^Az6m U³T!]n"Oi~G|*wG~6oX]?R}KrzM?HեeتnjHnf^n?>ҨFTIhiyb\,Ru,MwzdtX|x Q?hp`|vBn?Xr!B;tQ?F]ɏaäٝ~f;,v.L~SS3pjx?r,?bqfNQɡr圩y2y{v?Z^?zm}5W|ۡf}c\Dm=W{3o| Z??u\ )o\'5o\?g {P0nV e }^6gҍ6]?r} Ț IBHEEZ`D?c=x?|?W Su>۸?LqJlkdc?*l2%6ES)R$X@$D XЈm؂łUd:\1?39h7o۝{X_<{ogekV{r Srx}<ʅ)hzLA?@}7Ƞk_Z ըfydt&SLdKlValwࣳ!{#9{Jj(Dtu؀9eK(]+eka˭aKtOy?RE>d rb6UNB4/$`L?NwΟHXh>>ٳ?Ӝ_eK/GD}Zi6&=8\R˛,1}F$NF#,ϲ| jzK?֞ڰV׎Oz?{^ao7Jrg?d?2׼;{sr(N+HGMd NXge۩^~gEQoULuDD.tG1K;lVOB(- 2Ex"#!G qX 4GLi? {t6zȑnE[mǃK5OE4ȳ:fk-@bA?tOk= lu+?"dBYJ+GYu[ٱFhkx?b?fbpw\j}?%N?? gNղ--X/Eö?A?.$hґseq͖J?Lp{sm N0ҋ\7{?u?YLIMszr?Յ=}wY?hۮY p`ou uiPsD"duX:XOh C@יt>ϱhѳгi\A?}XTp6! QӲr,chw?Fi N 9FvɎCyf_SDvhኒz|qx?áP?◭;?~U;QyȦ}J£I?Gum>G?iQxǰh$2M;{k}Ǥw\"ȌwY??܆+fU? blΒx)T?YNVrWU۟Z]T!g6_n~Wޫe ǖG:tqX?ZnvZc}PCK>d/uD~c۱=q:7vF ?x(={ ?TQ<EAA5E@ IH&de7  /j?ujvڙgy?L (&ag puDTu(l$bzڷxqdl~Ydu?.[;XN<9y' Nf|+^h`B3֨now_vxon$b\bc5vg'\| ֎߽FYsh3av5]6߷kf+2~[zЁ?G?_;9\}oh,?j @*o>5.?@Ab??ƪc7-xthEM"~X oS֩vjrs×PyM%} TX1NkFأuy¹nFvҍϴcĂ9T?|mўPxؘ+Ʉc|}?XW[{ aXD??_h|TD*&[Xmr՟5 ~sNJW GcmЙ]ͅZxQШi>WkG[Hr::|?VANFy6}X,F?7q?ˉJ} :^T{uBSg],Ec[xG V?h'q?ňeخG~D5cb??7_25½%?cx/5NgXFaY[cYCIb᧲|eip+U:nޮ?Œo?)QRf2?uNXT#n?OHMmO=ZRи"$B|Ij7Z' EEz,3$YE^bȒ[ߏ*\?&iF^.B +wkjRRR ?i08Xՠlft$ 2?8l4r ?:Fp |\] c~njW\ .,P\\LI?u{O .7Ya@3E!_\m?b?@+ ?y&ILԮY6ق]miW?$? cGJi~&]^3O61n?~Tۢg س! kiP?ހ{?0l ^}߿sIKG d`Z-EH'] R?? Kio`$m+eHEAǹ?4s6huL9C]KዞQJp)(rLWzlsmm3]u1@ /cOI?Y?OQ]?=K=qdoV?m??}$57=-'@֩O pd?r>ݗu2+73=оd9qPޔi?},vrNW]W܆>s??f ' 1 fJ3v.UX{`<+uGBDĦ^?e~kZ Mrll\yYQ]Ws?&Zrz}?v ;?xIIHE{?>UH/?]&葶# g 5mY)n?7 &G[aLOKNH[U6U/NT>bU?V Z1t}pA)~_X{ ?yrO{pV?%V;M9H%tːLqK:pu_&a?~vT{9f'`KtI?eVt7?Q{v[M_mֈ?Z@bj 3?CcXySEv1 tmmx1Wd~.?\eд"slβB, jZyW>VqP??0-kjq&L\ \hVGQvTVkr?#aQzX-3h{?߰?Ѧ"&ֿpWi#? R?ѱA?Xd\t,)VÖ?Dn5[?6 SI?h<rq0:B/^IBBviD;Bi ,5bSup׮N?m?jb? Exk3̟F ?֧ML=T}?|AmĂEoǗ;gß}?KI"&d6Bx&?ɿD!ehCDVLt?t [?:w ?CӨSN_MH?yEcmTѯ!c{WzG7\j?OI ;qm{؎k:ImфC@?Oh-W ,eOz((Ih<?F1tBg?"N_zbG׆țP0Ј:0Rx X@PPtkK~?Hw|LH%?9v-iQ? Cx{J? ܿ?3Hihs.[cҀi2/Z Ǭ2 GL;OxT!bЯeICLaP?WFQ탨@œ&(ZO7U{!j(2|F`jNρ: X|>t oDP` f. Y( 휴?^( ΎP?yN|AcQ>΁w>H?iLΜǻX2%8!d<#Q2d$?΂Se3@ $*΀3N?8?VȞiO&'?? )Nbq?AadeE/ᅧ?׳rn9\KS T2JNX.ep[XÂrBlCy֙< 9>-p:J 9ρ-@)| Tj~/`\O=?Q׹o[kZVQZ0?/9 IHRQ<oI;Ø??8Fd/>kT|vnGB? [^.WLp~x[,˻ Ʉ3?4\!c8ai?Y BA =! x_J?u ZR$^rXwEJv_HwQ@8J!\NG듟N}j6[L&V5?|~?d<^Vfd1ju- #wjz~n}`F=ߔH;M[F4,Fֆn}^??2zI$?6o~lOEߺlT}efH?Eo~zṗ??tooKS@ڠiѦMݦ>T)ȑb˶|!ɲÒuIHRxs˽{./ɒ"ۈQ ڢyj 4pp?ŗG M>{?esmIÎ }iJ~%ȈdQ]ËEX+ E ?h?Ҫf1 (6 ᝎ?F?T JbZ???z?H"`7BVY!iBN reQ nvɀ[g1K[x}I:YBq9B.p-^3q<k{C23C&f?D?w–~ HJDHk?A}g`%6 1w#~{A:c7#s=H{(J[Ljюޙ!E$iui ]JZ Zc ?XvȄޜ?ȵn zGl?t?eru ٱ0WnvgaMLI`Oqa?[#N>8MN.??u5W] HJ/gH)P\J!$?H9p@d9f|D$?bƓQ\iĝWKD_5጗L` (b@#Xh??س?dIeR<:uE:u~͏aw_j{G7QHhηmot3wC׷jVS?@;S恤w?7$I?$م %\QbN1LkTHG?N8~?\C><i:jx.kBhXV?v?VK?vۺ\(u'bgC2[wqG&`?Q/ˇ!B\sTǧ[wu[0WG\ ?LMe97tzsycK@ & ytu]'l3N#GwwN3W\]͗?+gگ[kuByL)ef'e:Z=M^X?ih?@y^1_ J$?fxY)}?h-ZKb\i-p'^u 0K|/A'.K%?qQ狉)IL^ Liѿ N`q:Y F|,G.YB#[ӏݰBs! s$h p _yaLlj?7oIfY2aQcwݫŰ`#E'+߻ =?#Čf [IZ~ `c0x?laUpsorm?:ܜS~C ?Af;nώqO~KCntc?a}Idd$<-E=?1(y u?t. 2#?tM[`Ԍnoc+砙+޹˞iO!K XEwNG?1Zz3,(?iM[ }?~Sde HPo0bdf|g 8o}?U[zx{A?x K0UZsaӽ˲v=j ?dC1&oGSFCGkQ[켮??@/?cW?tU˯ |o`"=^wv;Uu!zoo޼cC?m  Qt>!I~:J)F*Q`#Z欍? F,Z^r.DJ?KTҬNԓ?eXc9H5?Kw??h'jp0t? L5?g`(\ 3_\% m;fzYj3ISkw Ǝ}zU?]?B+찄B̺[dw;ւzaT$1ed"eSl:M%?]0uTK,n d\6#v7ڼ?]@$??8]wGc?WǾ ZZ?)?p՝{osܚoEF6?=Cq/Idw;?A[c~<gfY2?O N֟4˂~M&.ʔCh`q??KQ5_jbi9}v9MFle.:8y'EnG?t2y=?ϺO? ^j'I?t af\qMi?u8ocM'g!G [DSul4 d?)1?HSȒ]ԣ${ѥ͡jl*qċjcflԦ?d0?A:h?֧sOiD2 !mN;hxyW>?щ?t?r?ٶLA3KyOZT~ٍ|c6θ>yC?jlWLDK?:!RO[% 6I†p Fw7\??KmڌϚIgE4JT0x 7LbU}`Wr??mV=rER"YqÙdM1Xb'eT ťS*LL=#7%*:CE'r {4?hnW&Hy>?Com@L{]A?6?8K3$v? ȟaF`|j.⻽ԞUoh8 ?@{zIܸ J84>èCysCq\kF&f}} =?uE&??SBދtU~p0+iBg{NVzp ϩxGq%?hxt{ͮ(7c*䓄O_xƚLb]aCJPz]oᲩ^ԋp?t,?}L8)D6 X;1?t|`Uu-mdf?7ˆ?7MU۶ +_ h?E?HtHI?[Mq?8k;>%˗KÖuZ%(I˶V`??Q?VDi]'~?8|?w(8|? D!? ikLpit6eUJ JS$pxt?TOG>Ϥy?Ic&J`4@j.`J8 Kv澀c2%{ps?kbǨ\> EX[n޽ǯ/6(0 L?̿?[Kcgl A*^ )gq "iئ!sZ{an3K1?f?$}~?i? LDlqUQAl쾼A?˥T?` s:˥gΞ=t?pfJ?Zr ݓT=L>ۈ |~͍Vx7.eK|ȧ?^?gppz eF?{=|?mr$ 7fG9*?h2ɂ喉Dyւs{ہ\foR è{.?$|N8U I,m l #?N,5ڊ!y 7Kq1c4 $la 4bs~d㓢 ?i(КN\ xH&gaÃKB@̦???٘vXqq?M}uxұtC[vƒ{+H?OK^x???=Cl8}Pӫ<4icGrL\Ȗs?g|%RQ Օ2u)mw*Ri;_U?? QWk;J]hij_v?Z ZpKܠW5J`0HTׅrBB.ѷu;;` tQ>jBM 3o7F~}ݨ#u ͋zm n*Q0fyoSEғ+bD2J3J?C.#x}h= h[M?Xnzb+|Eю_9k)z.?H%Ʌ6t%첐SHd=b kξ֑sW!xtpE7^>,3?~SOImGs?IUO~?iuw_HpҸ5fR?Nck޾f׬s&??}nC$XNh/4}޺mRVjT+jJgeNFѨ? P*bE Q<}(>}i>9۞m>Hϥ.ddyqB)M)d]m7&;O߹鑛Fݜ\ZZN,+i|I9/]j:Y^??HtM$ǁ#fIP8H?HG|"Z&`#@Q/?Nm6MrUDi lQS.MyDt3qxEcdYOQivOK=>uP?(寖\1(|^/, 6a\{?\sҘϯt1Nƹ n$ԃP?T0]k?%h??F5<:$ξku4oΉ7{S۹J?棅jR???b7_%_~reSWl.QN-\g|ũD~ Dg)7h`~Үm9{c98qc]Cyϯk???xקDw!W'3dVnZ#_kY06~;U`D'N߶3Am֮fY0,bȒmĹ4s؎mَ?߇$KoI %?%x?%KC?`>tt?[/xAR">SmVֿ>~e1YyÆ֩ENF=<(h"?]ѕ_?6"4j|յCBg}為븡6PD<#cY?"j 2j ]U?42Y}D ?{?2]IzAO ?MD=qv=}W]g2??P E2jeM?GbtOh`i&W R]9W (ԀV!?=?ysӵy t9hw#PC(v1D;?h?x?:`hYFE`liv~=S^>ub)Lj x.x$: jl ">; "szbC+-Su?g'?&?Q?3q ҉l2ƥ|ȓsӺ@D֚ %nS?DVuxhMK?u8M\??%m7l%t̗?h?騱;kFt:ك9l)1B,dx)E.U?0ܫ2urMSlS,?cabj~r@#6 ^ hK ?uK%Y݀CE@ڒaPi}mʲk7di+V,( QŞ/B ?(LIofXmx #IyA??>tʽɷXb\̯?br:PI7BL?KCt?`Wej0riMlbB뭊L?;;ӻ[权ʵNU{ [zWN*~+wd]ːޕAEr(>q2N?79r̙6u{sSX Π(z_) s &Q?->~9XPX Vq;?D!䖼f?˭slQ%1"I?:x ?;[kɾ SO??–^qpS׎:\D8n~?ʓ c'G?86Œ/rn3)Wz, %)S oUP?к@ <SK?aP`e@bPN X%egUڱG>O?8FUX*x&棝mm_YZ.Yϑ`W " pHelAiyZ?O?B/nXay ?Ƭu5֭9gaa [Hy]w + a?Xoh ?ipm/#lbbVәQ }xp2C\}  LNs?ԛ :Rb?SV[?=:'I?Y 7jNlk5T;?{ݍ? F*hdsCEZ;?{@$R$T?ϐ|Й}4s?8 l?e@kfiZ`?Ë)KDGl F_?? ?:t?JlmnG׭A\?H@Sm ?{?&Cc`[smR#'`UcKm?aB'O&T7msĤ }{~ea`?Cwm ֽl{I?4 ݴI?? ! ?R?@ @?<ˀ?Ydɒ,ٖeK1`q{؝q2Fc|aU[b,mzne83? dLsa*Qcl+eޫXH0꬏[{c|k3ᛮ[ް# -ek ?Dr VLן ]MPm6ca!4]q~IH$v3__k&IT}5ByivD-&MII CX#\dL,O@ݬ2r?!??5sˆX?<:7WFFY~DQckQ;q -67zo?[Sl?Zq?$y?N1` dxs)9?Lox%]!|*slylg6w?TlY,-2I`霜Sȉ?CQ43z7~xE~T&?hRe h O\B$A:2d Be?HgA3": Z$z!dM?;}iܬ abĻL^?^A.hopHǐ~.)Ǣ )2NщţAL? 8t ?4eҩd"~i!!l'?;b4)? LgX7Gm53^TT)p???I 󶞝hZ?gW(4??e9i?X>#sY@C? Hg)يY[u?osq]~?mow?p~X.eTJ{]=x.?ޕE}R? [pVqi \?w 'Ǐ9ҡP?r?W\Iޕ!-ȩ4v?zAKB)凂Kd%"?>̱xt3?db%D^M֧AEIdOm?X]/t1?ꎩ;>=޴ zpFWLH tBvjŏ'^?O|.VȌK Tl?דO?ε\f#N岀֎Eh)a9Ƈw # xxղָh旅c蛠KPfy]ndnD?a^%??ФrNx]q?̰Iڝndɡ?ڔ?zUҫÏ6?tΏŽEk&g_y?mLaj :B7n~ѽʆ?[Y@#ku;8|ž9JH`8|r{wp#ligQJ?E.!$KBlu-T{䊽画?? :m"?ԇ"ѧڭj  ZD(A BR ! I Cn'rb;cx|{?<9>j}wx~i~53|*= (?kw;p ~r~xV}bIu y^n}qeya O AhO$yC}ѣǬa@v(h i>? Ih*el"Q .ɦP:g"xXhI.DzovMxVZK] {A?tGw\NT?v̩BTPrjrr[}.s!#t?UݳU {EV?))HP?88uA̬Ƞf#x2$⨕yFu?T"%?jVGMKFYkKP`kUOSM4xt%fYYc^?> qp7Ǎ?b鵑n[UWt.^`D\N?qn?G?}TY s*8Ӊi;TФ &BT??ms?WYua RsVZ]. i^B ϢȋiAT]|FQr)?șOKr=( Rԝ}m?f(pҡC_`JIJia`A|?/QJFI|?c?VonB?t{FH?yAbEMڴArL3Ic? :OaaQrfxdp%D2X^E`@kW+!fx,?"dYTier FҾ|]Ѝ|D×]()cs.E9?Ygu{b?TɋĤ򢴑6KoR:/)cR|mo`ln 3#Dcm% ݂}?w?odTf{.Evw wiȺR?+%9Ե<]Z_gP4d- Z23?{H`{W#?̥? W<ˡ?G?pj^$֛.ōyɌ{:Q8twڭTuݍ?MM dC ! $\?w?mƞ ϕڇUo=cR>- g^e$?sE_'_i'ys!?[ ٴa?J ?bUѺ5L"e,lchA?CH "6ìu݂lMn+f?s?lL,@?Nڮ%G?q\rzReSب{vw?jgr?G +qZP%MΙoZubH<-.?^WASZ3yj0f|9|.ǃpY8r3/c޹/3jSP~up 6<@u|?|R! $QO/Qv6ŃӈC?%8IpvG~|K$eRPBU~jAŜ߭&??HXK)$>?bֵe7/GL2ղ?dtR|k[?,?: _@?L^3!~߾<+dĞ4_򢥳Exp?;WE-ނ`NcHⱴK8EBftculrh>ˑ`2pUb} 7ԫ)=Sl~odV,M?GcZ @)fQ?xʗ"ˈKFh'ÎKPUC~pp]nicgyesni'?yH$hg?iO?o2?;&ƷalGB`ENil 2[=3?z ?? ]V?`B3c8ssӯz[?[Y{bxr~?#f3}ǟtɰ|9'rFL$3X?Ot<3iOq+Oih&GL?raʏ{ _"NTɂ u~?lwC _x?ɬX:̉rI@TN R٢vCB=:홭E'nb?{@7,K%G,4Ff?y?{oğw˿w?>BB|xjl(,zw҅X*ʉk+ZXQN͚W"c!sy0A|l0m<??ݧp?R[UG4?S?zthC+|JX]Q.iC. FR`n?nJלyF)qbgCA KD;w#&- -)zgSءae4 ?Cm??>NL;:hoմMآc<.z^2w[}\QaEjzd?|" E7^?r,">[8A ]?XaTa ?[?9pH a(?SP6.?"f?tZE<?9637k??F`?q+@χ2? h<ڠ7*!ʩ?JbY?=iT US01sʀ犣%z߶3 ?R?k7??I3$q?Iw?v|$R|ߗ[mݲ$?u(Q)JmK>'VÆaؾb GCD>+^a0cB?Fh4cpƸGwJԪ1cBDs5|WG0>G?X@1??wЍ?!dIbi?/As7>?U_݅fK??VX]4[.vE|v< ubbJ?i?Ovz?Es9d9WgxZd/st ?=k{9TW@·<\S?8s|ĸT,sZ4?N&5|M ys f~:8grbrOos5|?o?8sI A aM\)KA?Xy=rf"tl/ML|?wHT:ͯ{`{ߡδO:ˎk??R'W?Rp 6D??v$P6?D?,o}".>=U}Vm~Å-s?D X݃ ^?!Bc[a7bBòшfZש L/ { tƫKÏ&DWņa d4J EձL(ĹQڋ0S.?XYYh??~LyYb?L5cmhSUPκMKcB5G" _]/nhG% Q?lR\fVki_B?Cx _ԩSuF0'RAHD?NlXF#?:vB^mTcZT1st\COT?hu[4RNEccO񧘤2V Ml( Y0ssyiuJ7o A3pE}V}ʷ˽"ui}Ʊ%'L䶊gm7)3$Y@h?B?>XDː Le[brǘQZnSh5 !megƵ>y Ob# : hɖnMf[{iX_rRPQY3d[ڍSvTҋ.*o~Ww_-TߑOTU?.27?Z:NB  SKh??f;?M?HwYOJAURMC v?tiPo?o1+$fsl]7GF\ݕ"? *hdKFFa깻%Cʷnt+zU3?=LT?h}0O=t:H@D"??hxp4 4P^= . %?g ? v?\\SoǓ`&F?WEٌ S?2}t|oGrEdK|±yc ҕwx x"?svaG|,?_&X\Lω~!,(b?҇?-gkd}ӬyUKCCw|h침hHz?҈fPJK2d8bqc? e0v0ZrR3Dq\,Z@ˠ fàNގ? `B?$@v_?$ݧeb֒>[lpofAa-@uG8??rLwj,yz\׫'U^?]&7f&1 /[d6J@I?u6UWJLItq+Wo ?J[u?yQ;kZ ??Z B F;`i֥WwʂIf߾}>˼A-(W?l.PMvAZ~zϠݫ)xWV7mY?sw|ԫb?2`+hE_V,t1Y(mrܖM}oqyp?_e(Kp['×>_k~1rb myO2rSe d:KG?6H6nrj·>\88[kɅ_Νo?]Mn|?N!یzǀ \b'*w5H EBl? eDA ;ױb\G.i.?Tl0mSufmV@[[J1yM7arZgy1M`‡C>_`h8Jh *-m?TTC NyAڭ'*g:+YvUj? ?joi]"VD'"h2ʰ?7/zf]oidg7Ҷj?EJfMݤM&q.d7{:cw_b|%6afcml+5SόS?93g ?ߟb`wpƴHq5DSa,?1_lS e_dnA=?'_83F'X?g?\8 ԲX-?{_QH$ЄFyU!T\y4n̍(H9 ?HM?fۼEI(CG+i1@X!o8LD(c?OQP[c@I PßxhK"ee"3 b??UuIzTWNyj_VLy|iyy]F?I ͷ%W>?7t{;M?2ڲl?8Mފ(#N?@VYl:M`au tImoe;͂qf/e?"?{i\`oan瀍}0upep:wdլ>0vU~snQW??K ?b?l) zg5ndY?0f??d~h`zd0m? ཭}dv6?lON|?4&z7_仯|(rbg%w?UKx6MEv^=5rpG??MmE+oɦtԙ??4!C%+?'l:Hul+?s;?YfB?ߢךvc%} 4IQ]YNҪ?+Jb]7(Up7j?1k\q-l +.`:%9;FZ?tpNB?\?_-^asb:?`?ts v?Sh7fJ 0R`?Ȳ%| 6 ,[XeXYVd+VOLIfKh[ɝwvJo?Dpr C"IQpA=pJF?l<? cu? UFnQTbb=;Q A}RU l?} d)Ţ'??X$ qy??KL˕ƇKnMiƼ_k{?Jٳpυ֫K?H5Asv?oO]Ӻ% dFq@z<`,J%:hqJ$?dXO?̜?dfO`L8Gn8 +\L\W>+Oj ۓ|? ?۵ʶOXZG=a5cDOKug_Kү@ʮ tT9IS`ϩA|SGhх~ij(z Ĉp(Ø7{(?oFL#FIR?Y?v?K? P4 D0 *$ !HG{c_r~g}uc}e+eEl9SqzJNϽFn=6DӢ?]U: ]ŋ?nЄH"%Sh[SH2@lbx@:xJlPNnSFz;٠b{# S;W? j͍?[]mW{[{@6\ P DM{[?~f_$cю?j 0EJ(gl)཯?ƀ(6Ee`{/,?~M?TS7Ѩvvqw2E_Io:[Ae|' F?v?D{T+" ޠJHфSk:=s3gȇgUhULOl@̛vI?0Gw>qȝcGxlߊO?GH2a]j4^QiYuO` Sa`?\ o¡[=|mވ"Ugt?}k-?.Ќ0adn2?5 ?eT*te_j??mZq`W`+p x dAKYj??[gtI:?3\PDtXmdٍ)@9T?Z 뒤F~{G{]ޜ`J12#?6MFjpq;Q Ij 9S,PV5k-W䍷ڗήVsG \sQ?_6 ڐyAfPsnߔ?}҈?h\?h^DJۍ.da:~rs?tG`]~6=?leflqTN V ?l璬[ _ء fәJ:d3 4fmY]?~|?>>=MR:?潂I]qcq?ӷ\?AS}Im-?HCwŴqkҗVJjR[iH?٥?4?!aC@hI $\?p ?؞m|_fW VZ/=gC̙?? r}d5RMʛ?23h?F؅R} >Z~JTi}ⶮ׆ u:B#yhOTl'އmwVW )x{ ?:? KPDCY6g?3?4SnLvχnSLs?[xj?lSu C?Glaȿy^}5yF*jv&]/'!Ysu fRt?Zݼ |K?ڄw?rkΛx{vwRrBਦHo{hZiSMW: $~Np DI?oS$+C?GceShn;yݳq?\s\?7Dۈ?ak;a}=L/,A:l<-,x>??I:%º@xHe1U??? 2eH|x0d?TF?bQǘh?ɵڍV!vTvmq[Qu'Fܒ.?Kz i3Hкؿ6CuRCEíʯ?O**?vW7_nMm5(Dasjcpqa~di"dm :ܢAJc!V¥?V9WM|M ?z6Tݽ-*[5Y!YLS:6CH  |H :6u“iX 4j: T4~ gm9ipr*` L;._YO\]X \Kr2O\bS.cH/Ĝan?%q/ZG!gXLxڜ74AiQKBMb?ABW o jvdį,lH[K'd1ZXɯ?t[- ۽@"dfŤ\pU 3:f†F-"@,Fmn?? }b?N9 vRsYοgY?v Gk?㭆KMZ#bE?Ѻ?ZD VIqs]5tGjr? tc?ȸu}uSzV|I?t?nAJ;?T{^ӍkGk%ܰ/+?6^U˪2{??x ??h̀@5g sX0 ?MCB͐d|e]s^VPvEP,Z+@W]U [mVL^ Ϻ7?#?`?c^…CkӞjSݹ%}RwԢZWΡ[_ʭՊ@oiz˕Kõ7sqlo׋P?; ?8Mc@?}!qi ?}-i5?h_5I?ZReK?bXh׍6f _0I]wTfD?,'a/ T?]'Mdg/TJ.I Tf? a ?3€?Ƌld[ekkI-?-uZ?Kr?r?ZNUI_{ԭn?{ k??~q39!NfR+bjrsNe rΦ`HUp cYc?:Dcb?\WYRűrb٬ zfm=­쑹BYяڵkbh:[+eV!"ohk"NI?u/T?ǩtb%\6Y&zt~i஽?P樓bT%ƭLx9ͥH!2TfxvA')Y?!g?;dRww9nvٞzx2'D׸ZiV(ݡy1%Ýeѧ .o Z+?_~̀c{KS3Wwm8Umc!ibHS|xNz}Zmo?r\\3F?0NEآyUxc@~֣Z{}KBw`Z)IMG/?Ze' K,S/eOzL8!Ga>jvN'?+oE? 7KjY| ,u×oZ6v4pHj%{uKMףcb1` IEQC?OA$8fIOp?@?S ~Ay8AC^Dj?cW痦>s3SKNIɪ;NE߂M2Bq??w^?cVOpI]s^ mWi7Vx ڡ ?^ͮG:yZ{4{bi:(}'vӂד?ime>BPXm&?}?Izܺ)?1O݉<%δ0v=ܻa j` /@$ФƫAr)?SH/ΈNm?Wl,C!?ggWfYAHթϧ}hb9Q?8¦.NBЗB@?uqN0I!@;Y_2@?<X69:EK?6A>o:쓭αVs)L`Qyb*AÔ)š)Z=t 6s}f?Dłfԣx؃2D /B2d0׈?fw$5 lN/e6 B̰uG gk. @F9?Uts ?SWAdwtwaۋɪs#-_QVbgexp5MY rY_C!PP Ԭ?t ^?K/e_ըh V B뵵MZ y}l0sasqZ 4~NWqr{#$.y  u`Ԃmkd Rw\bKڎ̷`XM ݂ QC ?lgF]PBP|mjy'zJLb1 Ah?n3 󰏉pvム`?l?-'D҇?x.fWq>!t߾:kIbv?ek\?~?mҹ&#?mшZ[jǐ+ZGL4=zcƘ?ar]ssxG?ƻ Ko[qOF6Qq|ֱ\vM;$?;uLTcI6O^?gh_[EtI7Y?N/VZ?\wLӚ??C Mv8{.Tm?X|ch8|]޽zut-ʴr]82"xC>`BhR8#\uڒRNꛯ$Niҵ_?in2#'p%)YΒmGӾFeti)T?nG~ԃVꤶT?)=:,E*_<V{r^󚒜V?Nb۸|qz)ZhM? vlDچy?UٲX%[dm?)>3?$gE?v=vўrh??gp{M#ƣTuݱŮj}kյ{g'?W?oD?b4(Njc ???Do?lezzVlN5[ڭiD?x?7dX"9P!ٳǍae2?4Zy:E4ɇX>?MË*\ZhjǒBTpcbW SxB?Rei>md|Qn?BywZw?#-mooJf&lP qU̜[e:EtIڮ]?w? ?|4O?FQ(m?>G^]_S鼵? ?|rrMNNZԲ-Zζ JErGBxZ? E?n9%Hfԟ!zފaUZVZ?"-nj^@?8ed]Y*I}s%d?n?Mnmcfs,|?zwiSYxpdDBXY.\uasG?4}jmxI  px<%d+A|JeZD_hY)!Dk0eW[㊎E?dǐڏ ;^Z[nySswqs;rӵxexZ,g|N?./Bhj΋G?_ @PF>Sg@E\]K~lI@:]ʃ?cK"wKE1@o?w?v?wA>UTDRIW`f?L[ok??D-ڐ?Ջ?kjiho]?;"waӳ?~+tJ-aTB)ǢӽwѯN5UV~aR7l:? !~7?|0}q.j G?9Ls? BUu=lClhfzn뱫봎1W(LIJ?E?B?WCdF|~SԴZ_ _4-iZuxSʮ*XY9).̠n{wA1NX'6?B!SS$ hJ??g~bMVeh?i;k?m?kweZ@ᙻWft*nLSwhQ`mNo__~?R 3{W`X s&~ *c?f{tܠjG&dOG[ZYu?ާI3NS׍/ĦNKqb `q$A@!n~Eˮ]Jڛn LSisVf曝|:^3?^m"fIJ#GΛrvN/$,*?W,rEik0?y7w_|_w_ ]Nj~<7~ע[J<\ԝu ꧡ?zQ FF[}su?:sjE}? -Xi^#+r?H)N ?JaOPq8V(3[|qs7?{ Rޕreot]LHPֹL\=d}xp?ыDB8jB hgH]:Zl?V`v????{aFlb?vkf9=v/S32MACEǚHTZf)M_dTUΕXEsj;{NۭuÄc?W?޳CxW &߹V5Ĵ?d° YSfg/q? f ?52HE?'kCWaw?]LI$< i!a x?!qM|Vbv?mzYzPc{:B 4NJAڬ$^!BDh`>P6-[?ӥCˤ?RGyůЯS6?ڻљ`.~#I@Pϐ Yڀ(J҆sj@|0? ev(MHrƞh?Wǻ^U?b_d>8[ﳊ@3KKC1W7??WƆ?nyHQIf@P$?$ ԡfOGxi"? ??3W???z?q!XبwM?"G}xtd]tz$ų|?tα@@BCy1ݚd??t|Q?-n^Z"K!j=??zVGisBϲEm HXL&á UWgձ+TŸ˺d?L}lb`Ijiz. :znL!LOARK 7% SшvRH}r(5ɒ+ze2\܃8<:W+`? q p4?3;T=\[#~4)S?DtKZ0d?x?,(nmnbpW̔q>YŴQ 3?^wqn?X~PΑEYBFH^x?Haw0 <@p?NW"?5?uCۆjqJ$#?dRL?({ HEdZLnqϷ̸߂˽vXbys?AD,DQc%?GzҾOZLVEo.=yZ]_?.J8q?iO]?}nY~VP|P\wu:m?}Kh 0A/#?eĎ-۲dˎȊdux\K.r]IK 3+@ 3,wicL}u&cwҜtM6[j~S7?P+?܌`nI` F8QP?BrK˫E8HWH. ?`fVXs:Pmy_K߻?|ٵH󣦞zhq YHt?}qsę]x놃eků-[Lw[z-NϧӚ?Gwt=i?;2㟝ů5nvi?iyN˞V9;댽M??1\=0 D̆\/ ΕqbQJU?k M5?2wEV?vYbЕ?*Ϋ͡ m\_?JEMߨ@QQֶԜQ g[ѹuotű?S1gz]KzSOGQfm?cDJrFy?=5~:¦:b?ӝq?m֋.)@e@قl(:K  qJE\ծ fBa@BS..<ٜ͊?ySDPB)Va_ZuL ?m`]]QQIgEր>m_lDNcNXڢd?0 +ȬjfFe?yYuy%|pId |?0.?xi\ &?6,8w ]C}҇?NԻg>EØ3)l%_!qsװGǐBfb$h?G{T߆$?rƐq2X0G-Mi9n ?'(QHe??/f\\ q,?a1~~ڂyBO6ARlҟw,tDĜY?$jID?!t:at-wѬy21y.?8??\ʐ$ >'1k?X1p5s??t #i?;>&5U_Q._?'=c^_zM_?WۇL?:xm9|>o pIKQ?1-`pI? 鮷6?q݇vIN3}ԙ\_?b@ĘM #M?t i%+ia!/t#I|b<:i䜼^KNZcOo9[>X?uj0iHsbEI?\ʺ}?bokzX}S]u?y`L7IDX4&C ܼqH ᇞp?I,F6C??YIxN#{ekT?fYp;T'?L}ɼP dK? ŒfAˈ C?#VxYCP*?9ˊ??͉cFޒ`yt ĉ|KO,?ÊJ! /@ϚDpF- x?@?E{>#QdK\@4{LfJ{e y6#r?i\t8}|Hd{xR^K̡4n#53A_5T,a?MOQQƢ&Fx@9BFjn^+B.eX7uyX" I:M? aC4M4?Qm4cc ; NE]? KA je91КG_?͕NS "`?CX$IxU,Mp4&)0if2K# $S3#kКZof|B+lemZ2;[vRg{{]uq}U}?b+E]w ZӅ?(feے6e?"?CIt~WH$g|?z1X\)1Aiq?h}A 3J|n88(7fC_Wt=zT:1 I?j6nQ$䃱@&Ì^V`?\??T?ҖtwbYi?p ?Hg#Y|.Zj{Uq1$?_:"9)l$Sd@G x] - fY?``|؞Ϟ|`{ qĜRAIe1]͢aLIDd Ea"p-ְtq%tj|`<^ $8F{Q3~k=?,5|j:z{ ᠓ih6{oUVkV/~ӿLo^jUqJo^?<=SO??i%4􍭽li~Hs[odm6;:񇕯zb>c4tx}V<~w"' T }?o.ew>dv[-k5'i>>/y6p?DfC}}[Ypuv3 sO NXLjj\?>֏noe?jleƊɣ! ?XtlvEXB~IV }][9|f}M磢{)!uU?tެ?\Sml9?GXV?qxϯ>~r~#HXVRԆNcb?,p_ IeSCm w*jˋ6_?UK _]CkK&mSIz2nY 78vvw VZuYz[WLŶ^|n j =Z?_ZJY1*LFl؛ijYXl9o_u?g*zk| 睳审2?\/gW|چi(J YKIF`$'yF o2% a4O%I1 1tNc<eMGGsHh?l72n'? ? _A@!ٻbZ@ Fm|/⋔i;TO?#d)>'?Dâ?`Lţ FED^ uŹC|2hHnNp.yEcꪧ Rn}k>??Wz#g'NNxMaX{{v[k[ UvZ pCO ;hŸ ?J|_U^s|j?J?d'??NiR%nT~kY a3q6bQ| }R}_k*?*[n?xdT?,ix? lN$ȃިes,Q KAiPR4"+ QYe$KF$^E@# _+2d:MX4Q?X  ?'͂H AHH?># .?O3JAtcǤ?Z"Z2*9NzQn6:?^mLL8u1[(DrHUM|ȥQ? ?"?c0#?9(c1\U!20Rc9Ș 6OQu$4 Nz]r_@:␝SB:Sm9ea?R)AFZK<OK}|`a? 2EQ,Ms` Oip? /5fyV`Sbb9\"C)`! TKfz3*x? ll? {h*[[ZK6bv0[zgϊ#Çu.$^Ch,J~F ?x{$? /E? OW*{{JbG/?4lq}?X:g?`?C:W^ψ@eM S6l?RΑq"aG?N_\>䒪\|??JesJ&`Lx!6cc6?l,cH @VKMU lCRTS09?U^~<?{LЉC{[[$?WK|T)?2LwHkfW,n6bǾ>~{9혧T.m?] ߟ՛җs1P `]Ȑ?2?<0&FC{t2M'F9X& cD" ,GF.:}L|~jC֙}.> B3G'ؖc^2M?T/?lx]o?Z?-˫{}NCVz_$ tԮt//fE-DΡJ9 sl+eXi8T~=@0ˋXId-%:+{A?:G'lT`\M, \b3BtJR}ת-9s_/5= ?I {?v{?{c?W OF0?zmc|o`~}|w^z70Mg&t1?/?ֿ^0ΩT9_FIr@Zˢp mϐ ߣ@k1q!w?{?hO?)/Ng|T[nj}kv~X?֮}?[=]?q냸R|#fm`&>C)ӌ?*6byX c?1BL%x$l< g)NXtJ)FDu??Qbq9O3i x—`BNAfeiNtBa:0#9`m!MEMzE^.?°R`frYfdfy(j |9?ֆ,??I{$9iHhCW 0nI뻣UΥu*0+S|aٜ֟n H?9;^mǗc=i_??E܍??\CPO0?Lĵ@ ttJۿo&[}?gyBc?ƴ[OÆuX w?R %5'q>QW ar5O9rd3B#lQL{mdiT8ur?kN oԍV??y[V?|F܆{!?im ¹ ZR5Wj!ruMZ[oZT ?!pBMD/P†>2OŃI2J?.1;m7`{s)LgNg??mcƦC\j?\bY??InR?[.7/䠔ϊOF DT{F?C4<e´Fk(vbJ<* :<˂?$v_ZH`ۘҿ?)*b9?, ga%^yUʪB^[*BRĂ"Ty+/m M-yv^?(B\2?Dru)-v~S.huPNyo\A?Wvv*{H_\B Qk՚??PUUÇu}} gEF~Wy[y ~\ ?h]eSDwPQFS1:?Zz nҙ}h̤3?Wa"l`"bHEzZ Q0`z 3r4l7`ۥlzb\Ǔ0k`:Rإ&~ mb?T!J??.fhOx'ΨWfC[@ MtwL!5R?ͱq?KЄ)[]?1i`2?Ufg걋zyXtxy97V dvzݼHdJ?3k ?ŕ} Vms-.uO@c8 48?҈kJ???hr 2k0A3@bqX8t Vq!`#K2,?6@ݢ EYBƆ H<?É,Z?@&9JbFYL[~G?nZb5Nv=?il?Zե\L9 9*;D˕rRZ\q6,N. ?٘|ֳ?M[oii`׾dS< yJzVNXjM з1zJBOֆU~vvnG?ܪDY,RS!3c;8lub Ik''30C?x9pt?sj?0u^?I1"Ɉq:?5+%d쪮A@M >OR"f?Aqq0n[bANG*Ѹn'?&Vb& ,?tDwp5?'`?O=Dq! \dF nGcTt R4:w1i .C&P ?ii`v*`?L?ABC ]ۣ2rI =0|?V6>{q]p/?0 RIY~2h ?]SEvsPՓZ H߷oߒa}x7Z*_M?$73pY/ l$M.Ǘs4W?omF^XKb/pCg.$↼ΗWbS S6!leHwK?4~郱>Ip`Z^ z;a1ßܔ> D?pB7 }?\qkӽ·f?S?B8b!{4FpצDؙ?[hu/ֺVpΠ)vU?ͧMTw4z.3!|6tWz+_^o:\4Ճ9@5?AvX?y vyp;rĝ NjvM j}QSL5?zn^Ovg>zX??JuzΎy?DIL;pb?Gux>~o5Z?O=5Wڋf M&{)>{,_`KyCKSsme& G r_]1lgTJi믾}P$Y?8Pʨ?Zh#. W޷{Yu.^Ne{^ή.CAr9lTD6Lj.rWn}ϯfqI2!j:>?~k v]\sE? g U{pbIstن?vY엯zGrɐ2tZbo/>8(ē;[y5g'?BA.0T&J֞V4tw f:? 6*RɸOȊc{M&@o? > Sw<&iJz?Z҅dM m ~{M{eGg5+S۸}L?FWB;X~xcKQ"SG}\_ S%i[j|n ? L?:D Q]G1M9 g_@bc ˌq2a t q鄌|"d@rbIs1qbr")Y? w $%Sa)?2ESYW匔!, }r2?ˣ ldl|ii*ej 1GކaNdvߎޛJ iEФLLkjό]pϹ>/!؅sՍ?Vi 鞨bƱਥe.kX;H |?h"ϫ XCRg~Ej;/:k| a4Vq`~{F鯾+ڝ,iGX iD# ,k&I?T?3' σC P?lh ta1tJsŦv GXZʈ)?ƆT?..~wcqVJ)*2QfU?`eиI)t VժH>)DkE{ΪF3EZsòA`3šzqd?BH? 9M΀JS?ArTQ]6EEި)QWKjt% h[S%]Qψl\3s)%i/CbOڧ(6&;7mp{?/1 Vu ?/dz ?Z3?I?cO]SDe?/K?/ j ?mtX#E#NÔj!X7;]wG7Q>䣞;||r|򮉋Kr4:-r%?'34?i1{Fخ6?OSfR?LL;Nt?ƗvP`c c2KBήvWڕJ{V7?pH&~{v9|爐D.\g@JA'̦!sMz1?(ZعfXZq5Pb\7 h[UNw؅JP]Ph]w:l'Ow.?E mX;ʛҁқ ?oYqJegkҰ: DBkHi]?{?bߣ2$N;TWbŷwQãI}M ?N\)`?gmD?B.+?ʔ[_\?4jwmJoޚx&&rnt8CX@ϒY_M`4΂u%.?X?A!&?w4gHάYu4?/r\c9JӴm*\?HXfIO*m?ĭXSf=k qZqh|Dl P ^e?"*x "X`EC0?.b,p-cC?l5Gyrԝk{אg_YNۛV0Sн6_?D :=Hh'}?k?3xEsά|Z^1hLGLՍ~2MVOG;~r6t ]߮^6v5 .S)@cd`?tjN?oi?k8? v ?'?.S)knk^x?t?DtҲe^V&ET׌XR0FXGo)!&0|p:Vt?Lnn@ cH sr[5Ӄ^K٭\) $.66D0v7l}Ls~3^km:jB?KU6 )6힋=CnNweigMG̏R+?C ]՚?y{3nZ51VqP)Xܨ;L㟌m'O9oX] 哛}0?h+%?w^B:/7%;c?ԶQzzL^_΋y)S(V*; *0[VE T4̫ |nYjΖ: kDa[dI?&?@˯j}u=W^V?r΁v̭9ESaKQsyT0,D 4ͨh{1IJ&9?a GX`WhTDUd 𶤀0 )Lր{1i)x?UQC?? CB{y v9 OA'"SUw5F>Z?SsnW ?ᚾuED? :lAiL3LΧP?2]??^Uv~IמdI׳?T?vo?Cx-vر M-HGEKa?bZ4dig熈 rZ39nui??3~{Dۏ=[g-݄?+&PYx }Yʍ%R?tJ-?h?|dD?f*q AZ{$N?V[FBKH@tr#D5 ;H?D ேH?~edObUHZ sx;`R2T^NӊݡŸ\MC.60u6r $ B?EqS1?9b??3?>B 4.H| \0$?Q޹ĄcjDyN>LYBbP` 0ےQQ? ?(RE! .IF%EkuE\-'%9_-& kU5RRQ?rc7 ǎƸ?`l`r5xY. , {^fgvn?WXvGSޢK3[sΜ?wdFR$*FPI1i0}>1A?n*i*e()?kh?$€*׆)\+ lrnO=02 Fx&ax vM@;Q *-?0E a(pT @4ie?MFB8?^mhj 牙 ʚt?uw)͖?.ݘy'N7xhKsuv*aJ: A"1a?c?/2 SJzMRt(t]"01@spEr]G!!@*E<0P?Hή0'W[kūXcnm<5w村k͎y/T?l-g?j?T'vza8\_wqѬ&:ͭ=.H}u7?9kcUk}fekۿѪl]&eͩNS?V#sGv\}?TEsN͗}"kW0[`y^GvX?)tϛe[&? y)1Lن~7W䬋6?vpq} ?&^ rz*U?RfQ02Mn? ހ[OSVVӁ?"YyNߋ?,*? 4~jrѹGg??V._=2Qls֨?bil=_.BL?q~v{Zsk٭vv3x<\ ~}b񥻧Wo??\9?NqB&޸[qlE=|av٤b=jwu'Xoo[j.~pm@rPB2J\-V~[?lwN/T8W0)/ҟ?s_7trS7CMu[ {ILÐ.??ҏ$mp ;:K\#SW=?cPـϵDN?<#Ն!Jqُp?sH!D {C}x9` ` PiBp7e''aA)p #?Bx䨉1?`@ ղ\n?ejq \Ɩw>z>?r1C;<`KˎѾp?S?}$6?zj?Vn}IfzB ={Kӱˮ?γ;Mwϻ>?b.eMn{?a? C?r ?v?ӭZ+O>Yr^*L c//YmVF?X߽?R:"*d&aW/r?#!1d𤓵 Z?!rE>?~o ?3Qdyвf륳Lgېt[ʦE9uU9NXV{f%3Rv+75~=RwyF1ިpͷͯ.5X\gWՎR? 7?`5[(dťLn̮x˹Po z1p#ückaudl?<|gwNT^~:@9v Rbquy% ?=BX\hsrv>T]:s??J<,? U~ov;l!u?^j?inU~jln>tJ">O?J\vjX⼳?y?q. eeaZU w$RgxTX?zThAI *x ?Qf@VEP?Y)QR ```?0Ei T yQB Bހ@KYtU]UUBլ~ i^Jÿ烀:%ɴH07І oh}M?kǎ*PKl{?{V᠋.x/tc{g4I?n?P{ç~n{Ox7`P}K9[?fI8̱?[VNru2q;]LtN?7~xGpnc]A@lQIyx?? _R$udU%PqfphxӦMn?I ^]њE?? jP7XTӄLdtBNUZQa aʰ@Bc'?8 N?o׎}xٜ>L;}T:::>}|?h{#H&G1Bmgv"M?[Yb[U݌hcuF6xd#lvL0}xIh?k/P^ {= |!$OxI'h^7Ymq?MBA?a`ADkAf86i BEHFF?Cky?Od5}UϪfjatb9LSctMcD(N3"Vhh xɤ?y>!IOą? a\? ?&VĕTFPRPP˨R^[WҙZ_MI^J?`fvǏaet4^J#Qo?-`I; FFiC ?&pZsz[D`p(f e#c\?՝[o7v?؂7KK{ёaVIRNgE kZMǣ pR ?85vH{lsiDno-0:f"Ef c3}UPGYrM{o-G/{`z =ᆈtPpIv}v?.-q?@IH4pYa cFxs8?$? c? t #41O3ёɩ1@yX$?KsZZݜ}D͙㚞&uCFjK zu\}FU~}?Zx?sLds_νn?qTq_Ȟi?BMz}Vdz@|'N S嗍?}2?f@nEAUSaR ADY_ު#xe ^|IMTө??wcyjYItU^`4 MNn?urD܁w+?#?O%Kb*M,@ 2I.XXJ$?5kOCkJ,?]HnK~+KhvM̫tb SeO?qzmK?̂& A[?aeԖ_1U~k`煶FMuc OLŞT7?T/WettC ޾rwk?@c)'RKJrӌmQ cQ5L0cg?OTMxgk(1olB^G hZzg}?ʮZ?,{*?7;?=:1}SMySs ?@ @G^vpTwJL1t??!so(e8hl}LU?k[AsGmY?3ξ{niYmoQ,B2=VQ8aYC})?IN~9%\eMaR'(q3fsc4Ƌ(?YMfaRMJFh?¶^.?|4. բv+HH %f@U?=:쬽???+Ey.,?#Q{>V9?ã Zi ?XtkPT6t?NN?t?1j}5?%(*(h}DԠ Ržػ{\Xlmә]C̹ٳN\DT$?]CG@š??XukK??wQo pcb?kI&ydi.:IdqgdfWGn|ǎUǫ-,Y\-ܥ??ѥ' -?1Mfm1*??!,IdkBaGU??ixIܣlf-sNȉIgӳwmGxq ZǸ%D"yT?QOTRL'c IhNb*J-?Hר#;t\,dҙ"X:T/-e j)RgjNVP7-f_ E?YB@U_Hgs?Q_jEWUi@H `c?XKX i|3dWWs3_V|E?{E?|U Dh MyyyÃ߭óJ3 `e"KӮ f"?E\*:L%O(/,fqu𢐜|?OnoAՕ{L&KoKfCjSN7h}?t0+aǭ!#gH$JHo????bCwlӃ'??ܭlأ|WՆ#_VN?ۧCͣjM ci}? l9j;SwZRiiTSabuXUS{&??z<CNrM2`G lcXia?@?-mB Q (5ϣb8C&/}BFoXz[; MfMzkMQP>#>>?HUqgv@Ƣ{}6v~c\ 6]ث7vαO᧝x~ɷ;.:ZOou&|>?j];?t~ S.?q``jk6'N?ojw7<~Hua?_;\?O<_?:zfF ~ƦLDc C^?69}ˊdC?awc-6P@Ę^?ԶnTL?NIxРӑgM$F?ZzZQmE9ՔSǨ?tmS2m^q ok;*Cg-[@U-Q~8?_͝-ve2|d~92fX?wV[?<2{a$?JA{,/,N혡fn? ?=I\pwʇǧKT8~JE0 ˿ b?xUl??}O?ޯ>VR>= ۛ}?8v|3Jc}|u|p xc]?@pb?T#$#??/P\" }F\'???E?xQ ?EwA@xFS!? *s:mb>(?j22$JDN̓D?n6ЎF`="?#$(i4*G(MșKoGኪu ʋ7mݼAVhlӏJ ֗Ji?Y\?ybKfH?{u}bB^&ۢ()e \QZ$/٢P%7RRdk C\VV?+?--Sn\_\W"/eRE9,fӆڳQ LAݡǁPWsÿ?˿m?~(׾@-;N?GM-GR$YcnK]AIn.?)?\rO.?C ?g>hbv??o&LEiaF|anÌpj;f]?iv "sՐW`l, f/[;_/Ex)Z:T4<ʃ]@Ph?UW%8AUJFdUjssr S+MEy?vLN$U3*ep%0wa??4Jj~RۋQBN,YUgةlnjl񵩠q.pje^s$AKtD?`.ƿv9 Vk5HZPx?E86s ?3 NFY6r@?"ZN;B|f9NCKs?EYv?fC`DfH"Hgs6}OtM^XmppY,?s4^o>9B/z A?* D&eoՈև>\ I@ԩ]% l?@רJ|*YgW2TI9I+ mKJTdR?yÂ? 'X 'ӲR) et1ɅޖNscܬ??pWY9)?!ZS1VĴnLؘhzm±w'f1Bu?s?T@'BX$q2:hrGT}uySsk;}??/ε};rk. :Wضp?j~lz-3n?KM{4/nSpsg?\ˡVkW6Fj oq?GGyIB$htl.Nb??p?t Ms*?%8u2zt4Y.Y?6o(y<т!HRE?lyNX6?м9u|s?6'n?fO[6箁kab~?ѱT$Pe{ekxf ϚOlx/VgBTG|U?wW˯z Ufٴ{rKˍ;jKe»6??'}PG__m?_nwdٽ?t{om4 bMOl -ΝDs Z\р@xȟ .4;7{pS7`~7#n6N?B:SPy%vFiw?CfJ~6Lrair:Ltw6mijNot^%MrxV?GGeq?0]}87 q_6e,6tyxͻ;;?=i'R9> &y9 7?S+}Ǹ6 qߜLѹ0TT {JZXgz}j]VǓ'k?CMr^-UH%5A"+qw& =rmjs`0yjjw۳Bok?='d >}ׯO|:gҶHl?1ɘw$査HG'l]S{֓?*Toq` ̴/6O8m??>}7= C68ՠ_I?6$D-Kj H[B1@k0AU[@_ ?ƄtTR|9@pǸ_? 8gIat=jAfVÐs?B-^,*jIԯo~Ǐ9r?Z]sk_O٧bY{?[?ikx?Fv?}n}*m?J&am m6?! FB `0w_x´v?C@e??#?}wM_ ZfwUUU?dS0 CC AH ` ZI[~Q`ޖdЩ !!#h^taRT8-Jڑx!HPz-Fځфupq(?e?*bGVWm@ ?1lb~?лh1<6ZH +ϖ?i28qd{?bV(gIwi.:eV*pLXm1~2{`_!CD _ ;Mļ@X0vyQ?? pn''@ϣj9?0j=bA卣NJP8#r1 ߾Z=u|zO{.}ɹs?|?`$l%<$qgX0 ؄(@?>-CёR@뤔JșN&BeSr.)"Z'e(O?]?D6Mr|."?TȖJAn~BT̗|iZU~0]кT( KE([qTB%.?$Eio+[T4^V`㝊rKH?ظowW!yoDqe?]t 4I Էnx^xE?-ŀ[Bū?rlmx?sT3/|6?O ]P%vPS˝RuG4s^,[h[,2?Gտ7c&`C{}vss?' }a뱅I Ii)ڽ@`o@ONYPi?9:/-?f6ḞčFÛix-}p7?J?V}нN;FqSFm͸k^hk:zcW?[?71='CK`$̸ZWY1hDYpf8~4@0Fl?P|"#,qu{yb Z,JGWچw?V""n9zң[kmgV^BPܼɞϼH 7[W'NRց݋f-Ǎ;G46h@unYu?6?/O?rtkX?z粱]{ ӣ?^[fOj&\Ќ3Yl{k\;41ؠց5\;G7ЍCB k:Z^Y4$?~i&XJÓ?c/}AتN{`fiHT?zۅOإcE2OO7aoYve8nPxk C ej1p0{Snws<i>zK na?>Ƅ,0L a?E!bũqhmčReF-QY>ъA4??%]?=ղ| PX{?k?GM?Hς+FP\b";<4[])c |<IDd4 x,?!b1u:I%bd$xU,JʥӀB&@6P!WC`ez>]̧b.niu+qQ8]}jΝ?=F|>*lbT,npEf?NO7?]B20w @^FT."Z#J?mj|?? ix .??2XFFV/o oGkt] `?֞ߵkJ ?UWoK?[%4 4|)Iz/&#JqÒ0p y.zK/CNBy1Y(g Z LּLh¹tb:&b?6-??M?o8ovMKUXqa?W)ϲܮk5bJC s.R~|tk~lk?Ҫ#k,v?0=/w?~ x^=&_]+fO?腥??`Fܫ[møںv{ Bװtu3@c8{?N\!?LF5L@OJ~?iXj"ϛ+W`Z(dP^?heĬe)0Y?rmv4;u_j&^G )[JL!òp"T< f}DHס@mQ?Ek՛?A?sRrXiMqmM ?T]sXB}A??r&-d1H7#?fo }QK)k*um-#>|:eyWmmH }=;?KwŶq~IQ}AhcIi-⢶c[$Nےmɇ|ȲD?o(RqrwIe9(Ч@?,Rb;39 ?#J:ҵ EPj?0;)*?= EKux'HqbuU$"x@*`dתIz\B=yuKj ̃-h^XZ<B#:HCkpe|'~U[>\syЂ??ZwٴoI:l?Dh? ?J~lqk=i?o4~ϓsx4 ƃR`u-I'?shkel:_Yyzq M>?[|?\xg͆}?'cyU'JhĻXG=;,?lt?m֭G^lc4<ف-I(mbgy4N ACִMwteO#`Pn52o\Hj1T =y$H KA166?D]i#8)=U"=,F_Y]=p@SS^7khjm=oCEm^NGvSb-|c~GlL}"j 1;ab!rK2 a2d?F8T׏$X T>_"lh'T#_8a?x0a +:l+@_H YQE^C9ZBeYW 5તb!\d矯(a3YR?9)O7]qWmϣqP@es-[+eBPHRL.Ѫ?Q=R-Jr6K!/%*|^LP FמW_d\ou|\MvSflM?!z+`tЬՅ |[s4a#>FPxFبӢ@ ,FPeN?"?ֳDc[| tt/wL]SAk3v+xw >ѠlӰd]AlBQDd?Qc i5BKDdpe -ʼ(?N?l|J pDgLr4;R=4TVR8QzЊsr So?f?8i;EVz@G/l'6e _xt}_ٯ{?^dgn|~q9UύO7Z?w -L6ߕw?jt=}}\][TNsR8&??EqśeO-gM|dl9?O?\Ie ܋MceS[??A ~xm׾qǦvl0?dGQTވl | ?줘8ҵ?zɜFPs?G+*2z`q)RmR)d+lX(AhJQw #GLN ?R;DA ?[g\?no<^p?ovj?vJR-˙R\-ȸ6wt]v}?x]#턹3ŽɝhnnOFzjRZR؉tY?mܘe\ל* x;?+J]O oνj%F&UbjYZ-?Ew+n!'.\ v k:hMҽwuMGL`Nx*0?tilj]DOЪ@eCCUv ˲)?]I B 'qcǷg5o[YҕlZͦ?j.$HXz9?P 躸PYCήsPVc\.}wo52yk`a`{-yݒ6?2$E:֑x_@QR(,v0my{cӽ?{}iyPa^X?zߢ5u%EE'nXz²ai[>Go`zpX]fٌ?jMz&JKy輞_XY?%uLȓ˨ZN?KDӔYMO?LoWogmWc?{5X~GhgMD,?9I C?}Ae?3b$߉bx8c?K'8*? P:;EB8?ǝ.u ɾ⣡Z[ihw4}3jkeIsĜa\bQޱ>{:`Y^TDTE .? l`[Vh ?8-Pd?y mXFEA^ +'J?qrND`oqEVcH[A{D o?~h.Zmh?fjS_lvMCȧ.=8v{е}OO:5?E]?h옹Wg-]W\w?] Dj/?fxk^>]o;mqby*r̳?X?X8%q?^gg*N?z{'USXns8ˋGj/?-81!|Ka?>#?[M:;;9LqdiVT@J apXKCpȧuH{3v?#Q?2SZylvy hj9RHsE)q.~E j< HY92S3?w/&;?S3?? o# ۶mз]^+K+K Y/|?rbeɅg<37OɊ@om}u?6[,zp?du?!U-qy5jX;> ?Lw>a??9^]R?\( QNc۶`}2 _ tXCR kK?]ZYi?Y;Nsz?9G??I>eYuSR?Q?QKdRˀC1v ?G$Qo-?:F㺻?/S֎SG<0 ܮED Í_ԏvJ?"N!ZQ r[W֓L?6|ngq] 5vjz*m|?ntZmtoM?CZ?x٣Ǝ?W'͚*c\T:r?F?.@!@?-!Bc??;}(B17?Y5Â?Kj???CZ]QI)^PH[?d?D5Z?wiށA?@,E?`j]|M}r o9l왨#!Mb=A{qaBvSs?6wl[# ߟyrv]鷴Wϸ!+?~]uhٹ?~~'T΅V-Գd(EXEk?LA| rQo!?ք9WgՔk6t?^316P`[~XASyphdǎO8 ` FDj@ ?iK[fF G RfޔVnbSV \J nf+Fds2H )}ؿgnD:˒Rج?`3vukZm۶J?-oB?!Kq`rńs?0޶߰g{IM[ێϿ$U烺t JP?fb,OAN1? **c~jP?2( m(F+"Q'nG!TkMvX AfX ]G7C*TxovwiI\ZҒ]u"BJb6NfSr6 NBZI'f^׬r* l"|n*.VJdyQQw>hlikE$R~ VZP֊pXR\B?TD\nlt\@csh? xF}V7t7w7~˨ oQNt`2l^)~UF~Uc+yE~{=boeWtD?ol?+R}ͺrxT, U9?e>YB5ϯfe0v^(椢w|<'1ļ[( E)[LeK++i9RzT?r)sjxQ]krtb&4~O'?vm??Y?}oO FxQp39N[l4bh\9ZrΓø~̯ Ixp͡niQz?0Ќ}D1 ӆfor''_TlO}aE׌Q"r,zQYiȉma 2?1HGp0,0l<*J cʬGP$ b|(CřHfn"|^V cy?" mh?`zMsbݗӆ_, \XN|h̞ݷͷZ)\?]??ᷰ]q[u¨~mi?{zY󻹆zg?szi?rQW9{xvqc[Nf{{:oOa?-lZ3QŒ Gl?CcV??_;?ȉcR7WiL?|vk]NwӉWN<;77^m yX>̹,tI[ش,];wjACY a@KF?t]e*$a??l: ?5Ki)?^,B{XX g% $3*ZHׅ?.Wꌅp`OGYWrb./ |1?L~foteo?]?{?e?rZ3w}MgmW>Լ}?|$?BiM?^r͟[GQJVZr>4r7T{o]lIGƁ~=خ;OҎݙζagWmUuUT \?!?ܓs? It}?;}|w?EGϩt,=^%ө@s( ?JHtۛ(?,pJ?,J`6 62\"'䗐BQR-@nZc`V[rvꤵ0uc[fWR! OD~yԡGp???> ??p= ]t?,b`Q` $Fj ^JX?BG{Gȧ?Z?Z?U87h͔kO_#κ?0W|/̚Cr囿w^g?Y^O`cjR@)BUAэ?ӼDn1(3@x,nùXBTy k;d$$s?C"J8ɢJ}R?X\YOMM? ne$p$t]FlwΟ{vry&z?N?^x_v<:Wh9a]ytvniL_`qqTsxԤip1v\Xj:k?P{s?}aq%g"rPF?t L_jl_s?6[4H9p}gN=xzZMs?pΙɩs_UcC?6hK?64B|L.??Gcdb6)gT6dI?$h{cR;BlPLTsLZJ??h??S]~wQImfs?nF𸍍htOTNgLKoaoV}2vWW>i?G~']lZ۶u?m{J? ?IeK?k/c:ve?[eɲ%QwR" %J$EJng qR`+pppL?u?;۾?׺W?Sypffӯ^JXS~m|nM?Xl Tѧ7ʟkگzzx_, ӏEsY?gd?}Xl&KEuigg+  gqLGyUI3?ֳZZn@n,g}e@?m[ᘮw?Bylꔧ o?MV{?Yb CQ?f_?Le#4Χlʏni?LI;:uKuD Vր{G1u-1Y9q?z?rFkMoX/jSL2\?b6 '9 VԐ eȚBjrPֵ,g8vR&mqTC $p= ?U? G&:.\]o}Y&lsGm5n}g[ekg;@ F 7w:I9@JfRʀa$gfFX?0Q??R9&-caX:-+FsLŸe #Z'\I?eyA?eMpV1|QL.\̬fh^<]otF~рŰSZ ꬋI?I}o?t?]q|!U tv?Un l>hxԾ=(1)%ᴛL?` >?~S?Ts j4*2YUvvs?j+ I؀)E?4Dyf ]Xޒs/Q 7 *`Ge(lRWgB.? ?jt>+?ԩ T?zh mFn{|qcU z  \]\xV9)B?,v?J[?(AaFrFj `"p|{׀?^^{^X CU%mkoLJWOOo޼yofV?^,I$}M7?S+.}??ÌpУ*bVN{/c?sاz~7ׯB~c-+S3cڞIJy5JV??ep^Pަ:S4aoW 6f mv6\?X,bqaKPz_\q ,D[ AW͇siaE<ǀ3#dnG_d?ZWA?e?<?eXy?~?Y:}q:̻BF?1?eocSg?4?c!KwZj?UR?*twhnP?$vh??*ȱ SDqb[[????ێgo9?MPvmO QA ip/@ +b? ;/$Q+Ι?_J]?I~&i|Fi? qA& ? e?%oڵ?20DZbݒJG·2D [_v| {t^넥PjQ^M4}dvH[[jj(3=dz\n ;sPs]s?r9=Jr{}cDcquZsa?_s0CyL& 5bM$DZsqTЭ;GYEzNM~i=hbh9fn?.ǛZK Bc?L;)pi?+qwh޽o~EDhdc8LH? z`tRQg9@F ?*CAR,- aS_Y?3XLT huTO\B"- 9'a!!?JHApWFK I?y>҃?vb?>}Ǣgv̎u󇕗ߟRSq:ҍmSjɥs+SdJG?}ˆx[H NI?ٖZ|瓰N;̳IX"?{?r?jŕdۢMMXe?b!ԄDn٤tli_,gBZg>+򹔐M&s"l&QS r?EWωL~\YG΀?VsZvsmr@?{L*t]\ HlNv]x^?]@?nm!oIMhl@ `ovA?w_lBA?^HNg9l.JF#w-{JJJߟ^쎱[/_no|ukd{.G8/JFGW#o mmWlЕb+gt0c(? .E,5Ř'5~Q0ý!^zh*9lg6?7?BKA{òw 1t WׇMu؜vwMxaQTI2ڃGL NbΣMSsO_ziqȎO6|8!0ji?սz+?yDyKu庋)+*(+>kX׻k?9Tz B wOo?3rlVa7Ɏ4 xqb򱦧?jo~V#dVCu7?uU&qȯM?ܻnن/-;f[E(wX̡?߭QLҏ?f==䅲gvM?M~#$ Zw֞X??W3k0쩭rWf?o⚻kWmaOw횛Qvsfނ83vLv?w]᪻岯"Q{lW`!?kK++|NcmG]]'Ԁ?._\\rxKUIWx&?@?'Q̉ǻBxb?f'G$ dcH?Db.Wj~qei TBT])xܩh@٨_Eⷀ*m'@W({c7^YxTM5v#y?!gxʍ6?:t ӍtSyc M[Lo -2WCYN+[O2|u~?{G3j?؟c7G̗Sd쓟^?&pc?y]7_Y`dp~|:0Xߠ?dE7FGp[jV6 »YXt$?1RA ?B[SedWk籉(Gr?[59;?~ UI|17km|o?>^q©?O‚dBQaɨ@Hl;kmbjC>gMlOշ?Szmj?t|jk9 {?Tf=sdq=ch 7}@!P5?j􁃇v 膓u@\& Y_4̦B&iu YaUAMmnN´qA\=~  4Y4H@e!f\XƷmd@G7?A??F?9zS &f?!EM>8[kεW??^?|foZ0|<% ?js~ ɤ 74AYqSHk,G?"h=W?VRVUP̀4 .ZEjW+ ?G?lvZ?O| 8 q??.+SNBE]ntPńN2L#]'3@NiKk9PT.^ZR@Ejr1 ?˹EyxP^CF^]έȯsYxرZU E(Uk?UJ *HIRadmQ\-JHK(EXfEqÀWh*`c`C?6 KC| }Q4ӖܻG<]_"'okcMolH_m{!G޼]xKt_ q!#?:z;<}ԖM4]BvQerNNOK#wT\QHGi­Z䱡6#H\f%?)̫ͫoEMN_htyTNy$w1o~oe OJ?rLh L@"??7|?7 < ϶Sm>`x6=?̈́?8;ĚnzΎFb6Stp?gyS`~2d Q??{6M`=rzcx??UP*:fQokWW!ؘ0R8"bXwƢ?IAVV uQQdmUNRVdBȞh?pJggy??xYRTF2ɋ2'* I @R*BTT +h[IMG5v[K^]z0roa q߳.`x'Z/r?IK mDssqh眨\%vLFA"d8:!y=` tdn?uBESYSMuQЪ1DF)o! RҦBCB@?q[f'cv~緳Ͼ|NllisIN?>J?Ӛ5;?r?𶫆?>?4[) ?h]ɿ|nLm[jo?R6m]~z^}j[o? D?`֐Pr)1r]( k_ p[ nfS? 3P?q:xD0?u>Hx;Puqc\`lΙͧy< L>/|-|nPxTlviObCmS#+7Nk?tWW HP֛QvX_X4RP&Nf7?ZT0ǔi1?={ɹ趎EoYKL(Ix|g]/ێ???ӓվ?Xw?MmrSWG?{~mkhl#?]}vmc9x?~qҾ;?LwYjvvu󳽻wޱc6R;+p4h nir?EDÂ0!gssegUK?hOYO,y݊u?qM넃l.EhSl}33t_vOaVw`?'Fbꉟ{{շ?O?p:'q1@DsQΡSGhd?I+! y|I2r;F׆u[싦sŦgQE ?p5'$Y>?o\-v̹k׮3g@`W|q<DdcGGH!D@Fm O?bs@)y+M7)"ZhY?~fn3s yVКh$ ?Y鐒$`{Z[v?-Snc8rm»6?+gp]=u"V#].D?HQva| H| Zi ' dla[? @W?K?JRPxSG?2 z~S(i]s.RtI?B X:-չ l?B& t>@jiF>ms#S,dK?>ݳgxl @PoJBi3/W.8mBƗK[Yڨ?],F UX ]?˛pD1?*P??`WW9]te6"7Ѻ+{Q)2?6Էu]yR䓜w.-Dsyve@2\t y J?`),?3~?E'[v ٖپމ?cAc|*H ʼ?b)?bXrT=O/LӪ/z]O&/|&[_??W٬?4?^! iu4MFx SP4hP CVתU`4DlAMYzʵXr;??ҷߪuc׬=k-tUg[K:%GET?1SW^ WUISwq֮jv;Px6?r+IEc|8q._K_`nfi"6>Hy?IDk\4SXD'&goKVV`qG݄|cOsU5Jܓj:dgɥ{I}Ꚁk~:e^am&x:Kכ[?A`RUd%Fm)ĭ僚m`?[˱9情LX]PZ~z>U fP#lnB?ʝ?oZRMd4i#m%&#o^V{&+]N랭?^nBqgcuw]mɏ_kzar#?8miOK.Fʱ˶fY itpLV%VɯWV!꘮}dG?{NZ_j ^V%c?G l˵^?ksOhyH3~Pʼn$+?d0?HX[xKq?NpAhq Alƨ᡽0@0YRk@79ts(N`{Pq`WJ ohn|=}I}W`?r?g"rGc?A(hyGJI ?:H{A?C?zE$e/wzIs?5w8q* -<'b=>CQʳٯo?HLk+Ɖrs37QRs[nG‘8}Yh'0?W͉yNdd |z@?g`Mp? n??40?AEByZlJd9?_׸1g p?t ƀ BEKcIn/F8\_װ/p51?+-Y g5C" Trreƫ ?R7E˻|kDxT0? C?bv sE e0G}1HeD9D".v^b;YzMfqlKrq ?]@뀹ƣ^D y?,_ԛ/߄,GzMjT7mi?+[h95VqI>Y￾zjLjQp\PXpB 4puNkDD}kkt.eRYxfnMtu0;L֒Zmdi56hg;.U?nZK l:ɦcLr+}dh@X??b dpf?ٿ~cERԪFs/q5N+Rgt?:?&; 2dBO`(jU{in5m2ݣs|?ѽtUw?\?)vgwDw@?PWk?˪F:WڛuPNm?R+ra閡RU+n(l)KE?.p>2GN{C?q cb?uuX?𱇢 qNv\ر۠ސ*vڎAdɶXljZiR %Hq_Fs8Cr IQ?Z EEm[7TRa0y ??"?1Y?EHIhi?J?Na% ذ(JD ;@jb{Ճǎ0s ,K]g6Hxıebnj[M?&lT v7لO4bgt71tvOvݕKsN BTƘP4(?~*fB17?p?~mƦOj -s?\1ᩳo<?':n̶ս_37|jsmKkyY{G_O`URAP!eAgӅl '&Scu-Sx/IF3B"Za3IXBHYإBM{y}aP1!sJfrՍVXܜp}u^m1۬`g?ʮrgΠE9Kkeącx1r?mJ}͉5嵍]NT?r m(2`!R:b w+s N!% k_wi;g>M#946V?o񸖽x??Xܮk]pl98s~6oO۶ n] \?p?~ Ӫhj6 59?ϺTbxt?xޱ}Ft?ѓ{??‡?|UsXsxuMK?BqJIW?W??LnV@׾8Q,Tl4~i dty㌊1YbZxW^UU?D0iB*r޻Gk4-cHײI_rRw?#3.? yIPH4\k?Hc'??<bqƌ,G]0e1|.b.?E~AMOvLuGwv_ Mc&,E]Fg8r| #QCj=Y ?@߉h*ISh"tv _?oq0?<???令EGK 'kMfc?g*P,fWg\6Z.d\]I&TZQ?Nr Fns;nUUUڸ-mDFbAA5ҵMDk@zкXTo)?C9P8 aKu]rwPJ?py&KI/v˻ Am;nUh]FU?NI䃯~{Aӡ{[KKr%,B2 )ޭl&o+cGq jVܔ qT?P/ XOz.e3ET楰^3?'(" ?e!?n|ݴ?H[K=͎u?c$Vw?u<v?τxF! s؃yM$ga{IGQʳrβĘjeׯ%f 5}7%d Ze\SıOO~7z^{vB>I?EDQC ?i )`ֱc??`|smf?vcgf]_>T ?kҧ71??v?a=%|4?UTQjPYHbV$EE$F00}ɀYpBt( E-?wCjgG-I '/6 ï[POŀ6B^E֏(Ey7) H`닙ĞGf΅g?F?K޾lo5߽hbQK_?CM??8?j'l0U+G|ff>Cn7wn^Z{g,G|?~gy2R{?lK L\:Mk4ƻq?^+E@?ht8i딟M?&J? G)j6kB:G?I{??Kj?UQX,y ZNY{x{jsT?lA~lbd?)`?W9GZZѕk妈?YRSnC_FT\ӽ:+d?z zҚ,y*ϳVsD-Bu`m`X^{D]oY䛮 ,cmXm??P/BOOG>A~zZuPCɨy^ya? 3?f/X?;՘~x?p>.j?VsKJ탥l{5^7?t=dNF>wػ[vԡ꣝?.|0 "&(UFg-/\ͤqRbǹm,NXY D ؠUb :g4_jqU??|Xȕ sk ]p~ݟ?u;@a꺼V,Ripuz\?[?JqC/륭J 0`?2 ?C` ]]љ ~]\u2 PҺ?? l?6aق]t)??"O}`oq ڀ2>>?03[A?ٯ{ ?˳N`r>?Cd% #r 6?q|f-W?KW\,HLKr#}k]˯,R]xڻB++VW v{c&4 w]mW "JN#pE rq'f?u۶y AS`ŰR`?Z?Nbk?$s^O8SR;ۉmb'>$Y>$˲(Q?R)(lɒ?? lؿ //?~d}O6N .]zT UgU׷,\?`l?kÇ~?vyȒe"^ܶXN/N{encMBTʣ'JJEEdo,? i{X`<ȊنH>W8rx\dgK Eb(;/8 "Ƌ^ ގp S ?;vhirBLl1[^}olxsi?c^`;u͎=$ [mIҀ3cI?E??^dl UhŁ_lhܹ@/|C4dPuK㒈Hh?g3%9ƪ&s?{Ǝ?F0#8 Oy^u|V\==+WX0`Tey IXBtB?a崲N?n~†ِ??(VBRh-?J }|^ac?Gy8?M:bA?<Lk<}cxXN~B;gBnmu]ICKO X? .γa!j=I-DZ?КS -(YD@h*?~$4n??QOu?|PptXc"?xFD,tϴ>p{M~3Wb&-fЀi)`'h$lr-gSk\dsjy-^ˣ]Q8vfK/}'S@1h+V b%tXtTi,T6Pln+J\*?l:yR?+D ?PGކf B2LK%EhΗɠM?$m?T6?u7oT+`o8VYn{o ~x Qnl?R oU WWoVeꕍr1y>-oglL?"Qz1K3Ԝdh%`̍u鉱[?DŽ !/e?i+_{sFOtil_ *TvwcaRXeYZH!Д6?q%ssٛIlljk؞c{f?8V{ACX;Or|!6V?` ?iV5߂U"k #܈cKWon]?1i"İCZѢI$g0p?<#ãbR|r$mH gNg?T 5Po:l(w?t]Ql?{5cCXwq׵N;I#Gx`x?N˾oߨ9[l}c-hA<( ŭgk^d8|6꜋y"geIgꢃpQS$#-?ք]]Z[moFqE?!MhI)?Ti؝Ox+'ʪ(+Dmm$UKMIDM\?ckRU5'l5?B,HjZ B ^3kG%?ڸ)aHGQ墤? ?%Ex u4OkPF??B5b6,tF|xEuܰkx?Kc}f?k=g6Jb<ቹzuUy z\BXn`XPK!'[O0ivJG6LẠÚ͢$*ЩAԲ,E%tXY+*Yj$11T埯@Б⡳ ['"r2: F?j;a?9ߴ]|ۍQ{vC{ՋA+B?y9yNy ;:Af~'q2L,$MLZfl:ZUɥTCnݨܾ}޽{?' Euay1Xȡɪsj@?pY&BqmE??kkgI;QGК<w @Xb Y3-Q.mYE_/%#fo66Js8 /mQa,]|W)-?XZZ36K (_̿Z+fSIw"WrlƼ]]?w1.^ICSfU:LF{Z.toSitQf4RČ ??aaOB@X $@ B ;v^w_}?qYVj7@#Yǟ=ߗR}*?e_lpk=PcMJ?x'r\q9\LU@54rՔ??thwkbc?tG8؎?ȒdehnbG1))LI?R!'wT^?MEF镻?ֿ}Qo'~}]Ã?[?kHH@k`d$l"@*ݮi?/im?i?+B3l??QՃJqٰx?AU :U9QI&'jS9r u}羳ol]~[qxxO??>RqlW?>c`Lh8EeewxKE _]\[õk֔q?e,+ Ļeκs]Hr\p q?EI#JWbqC -?,ggfbl6Ϙr2]-ffs?v.VI15?>w!OIoiH6nzsP#k?LeA,tjݯ֍ rsm:Mc:P|b6Ȧiܻ}}Tv^eWǤq(( 9ʉ?tGh [?L| raa! Q9a?9C?N3ʁvD)?ex;;?l`=ssަ=5tW}q$~;Z`wwxor>Eq}坮K_9?[L?;Xh{?K)E`Sdύ@%yzG?r{f𲖽{oC u˽RӮjq)9Tͼ@\D?ϙWL4l?%mcWh) ??j 7FqJDCi._{͛k'!ŌçbhuH` xk̶mH?- HoO-? &gEA6PE\D %!:No#c X?t?>pJGudA/?6au?~?X5x{yĎH?8Rq)NU=CѷIn$%'r0H-@:eل@= 6:O??&?: ^,;iqb{xd`Ž<\Q?8SӮNi3>>Ǣ-g^P42!t- O*,>e<<1?X5x+{:X-ib3騗Q5C?VUU=htl2?0Mx|?P둫JIZ+BoD6uَ0%?{?|?wjO;$?^?EE ޒ?[R(eKip5;gf:amNZSl3@NJQCW޹O8o瑫_W糅\yՅlu? 'C q?@M@\Bޞbކza ^-hyiqqi5-?",X^? ??Ћ? ϤS\^*\zclfc,!S?@«+f>jlSjjVLQ\rf2tl`Md>;,S-PH$b75m&ucÖX#?ˊmݖJH?x/)rOAQDR$%-?R/R`ݝ?)?Q|J.?{VTMp_n?qVf6H?Wӊv;;`?^9o[ ?op= H&*F\72?&r[?-?FE?uމEOv{~;>zTڊVYEcԸR0jY?8_h0Rc3jǂai26Q?[=<~[7;h?vw  ?c{P˵RUGET?7~Ʊ??6G_t_,2?vȻc:m":?{rkPK}3;L NJ<̀|d\OCYu⇞E?D}W??dM6.u5\\h>4yk-Ci?iB~kػwoII$U?+D?Ǒٲ (S5Q'4?RM2?ҬYZ/ c`68* ?![jQIW|\ hEI?aeQY[QNa^A+yr`n?̠kp`-Ic겶e`SS+fo5gnٌC4tp4.?!+ue9f?Z=v7qG'ҔX?%,Ǹ[O!?=8H1Y%x~(Wᡖq"xvF?~l QET?2C̆?qC~_]o`?Y-C6ͱƮej3[;])7IR@?ƎF)XIJhJ??r*O;:e?]нwlӷf[_p};ow_??5@ QP .G"^vSg(w?Z?C?.? h1|S? ?pOH|e,'huD9Q?P?EGWhN?U$8S?D)O?mP{qboH2FC\" `5/C[|A B.  @R 2YA?Da Qg8-P(AD4A`R$?BͿQ^>s|ZV9.4Zi:?ަGvwL68uJ30=6\xIݤk֨kƾeˈk ?8?ܷkxӝmKozjܾH%%?"qZeHdy1S<&m?!$\?Sl$rX?E?āb!s|&_.R ')"?UR?(%rg>eWDƥ&Xnut`ˡ{~ ?b?8&l[ܲ2B>d \&f|N(vfŧ yx樥{uabVi&.k~?W LV,(hYS`\EAZ)Ns3G UO5Brr^Qה+zߥ)Oegnx_? K?n?>{ ?q?8'Xgi|,:mSm5m{1dot?y?tmn&&?M,.tlo?wngl;qlKߊnb}?kd?WͭoX.]ð(M(EvZiC?]C$?\n0FuM߃ߺuBk^*KqFBf$s??AR4[hu? ?TC jeIcvQ [ CKw~4Q'[n[{Ku?g~bG>kX>xs_hv5u?ͫ:OD6"Dgi? e2"}vk: nicW3,gO;m\3?0̎H9\B` 6 2D`?ݜ7lրy(ZMFЭp*?HIřh *+?VtZamBp.?TDLʹr.WVt l6bdTEd{g3erԭ*FN!W˨2HzWA"?kb.O;2AĒ6Sa??hzනSK?E =\1]yܨ X$zr۩}QKXPJJaTox+ D !V<JDr$N%?;C.?c Cb2u T|B #Kl\ <OeȉDZbQrr?ǿO~ޮf=w?O‘???ö )Ff,&bP?$?r5Mt< W|6OL]̤ xlyݺX,dW ]#T9(boU@kHLmRA*%0vR\֍]?H ZQUs8ZSv`m]шUDZ @E-ˏVV*?FI(0:GE5J=zJBI]6Br?.)ʪ4^yV*_>kPx̧cY?ZD +EG1BX,e2 'O $("W-Zo_=WpsG?Nc۶%ðvaZ4hAinm[?ݜM?N?c/_ql}%dݢDݲ(Q?RHla ? }X?Q?ZLٺkguuczr?3k 1< A\hemu1ެfe?7?V\i8eY?mʆcg["p5iXGk~~o|?Hnqfݵ]ḏEd`VZ^B?[?lJ &P?-ˋM<-@B 8eBM+)A(aO#Ó4 nb$Dt^X!pMiFXx<e?:D΍{/B&?,g],FONu#EQ?jADԃjx!9CeA?gN8 @uX?TEeDpZplҠ0mxމ w?c̘d?O w?xᣒQ?ݴ[p)Qi9?kXr P\e>JtAk9fR)ĆCJmf)YpO (qmC+vu+L?E?od_?Zίb5FyȡOֹnT7wo8٢1JL`4Eu\)dtL1o{*? cAJAii]( b."? ?? JƃJʙt ILxy?So^EaK̘??]j ,?>?r3JK^}yRnӪW7gbՏZ=yPjggS%H?uU+wfߓNy=il'}jڻJy:c;qpu6j2af6FA "WJ#x|j꥗_nF{??AcqYB΄DMN#*#H#HGl9X9v?B4]p =ͦa|(tD?h`Sc]G%@?$+ ܂A+W۷Z$l6|~c?;vTO3?R@Xךzf{?l,a sN 6l@DhJ0>p?O _q??6xP?2z8?{}Eo?+qx ¢Q VY *#E %TLh_~Wo껯ܸthrSԔ?xNI?Of?bUc2[K" ƎBD? h??tt3LJT3pcz~⋯Ƚtb{"ΤMd3Ipu~+?pN糛#?\t]Al)???DX\*E?NX)?< N1 9jpKpR/?rJ, n?N?eK5<Կ{H?*05BAƉ?]Q\w"ESڤ4B BH%"?cc؁` > 6㍯ݵ٘fٹvfgOi;R)*OYFzz}7?]n?A;m?݉ƛktn4}q?߽҅?`WK/}8Zo9k?in?aowWw6z?~Z;?SQ?qdZV`wڜan.}%)[B_U |H ?9difD@ep)pgaB?gTf`kC EA_?QBKy:5tXi ;w wB48ƩvaZ]?_6#W/Q8mlV8D5<;salɫlwi;jg{꿪S]xJ۳}unaAX^37KN z[ǧvB(R~q> ҂91`^azm Zv_?ɼxfxd\7J 6;zأ^ )>? PMAz[?TR1;_*JEy(j 0\@?"E@\ TlrP.|_Pb `e@xyJEר^T"ܕQ BrU\{P)1KaZDw+K盥Y^v Vj[fV?^YpT??'Ӿ?7SpY̤^sX?/HJAq7XJʹ)?JةsRs,?}O0}g 6?m^k̋H_p# b ټ^gOI?H?DI̿??BiEq? gզwhwM7N&?lII?cqMY-BVxo?+=Y3|gbO.??~:P?~R?~[QgþѮs|?{cz~|oH0F?EaggC?̒r0V# u?Q8ħ^錔tFAa}$ quV D$Nk40ƸV L΃p|>?7??S,x&bݲ r@V̧!/AbA7H~d6R H(p[?-? P|Q޸U?}B?gIŀG%ǹÄnb?r??[jHgb> Q9Dp?K +Kإlt}t3)2XS%x^KW YBrf ږ16 ?Mm4.#?qi&2ЖFZ?P?ӯl'uw}osc??h#n^r혺]hz?y;AظtFAN+?F̯?`"?d3IF?ҷי<L]T1;Ev?g?Vaӓ."A1^fx h ?'?מsNV l`lMSՐ%|EH? 0 md-?'Y@SulKZԪV+hHV?pM GsS;jLL8?,%i2!GV BY?#Wu?r?ls(m|w8е5[UEb1Yo4l?v-vЗ?ylF|/q[gM{|"hMO &La?u=n^zͩk;XA=an#FBqG?#r) wPOQل?r4Ļ(K?&cxJ@kYBKVpQDWK?P8 e2RRXdT)?}*RL?dKT Y"X(htvl?w??\Vas2 \<p伆|>'dPt]e0bt]4ղs ?̚Jsuiki=?|.(ni ziT\^đƆل.?_)ϯKkpu 9zy򿄻'!?M`R?fF]Y za?ߖ??jMx&:]++Y m _屎y< =eSZ-hl nbqp'2d֦mBK3`Llaz?S`?Vn?PɅ]2>u$QC"c_o^$˓qhD/l'?=F[o?If M sppM''c-IKW8hMN]oM\g_tHiN'LI  LĄj3RM? ?6lK?bI+iwZiڋV/$MYt&?s{Ѭ~x黏7=!O#Rz>\. |i RP~xsiK}M1z<_kVHǬ}tVEq?5e}R!YjkqØDD ꆊe>Q+ױjYYY+ Q P/-YTZ@?oV?юvjIb?GqwelM,6x%`k>:]I|sda?MrfFd k?TSn*?i DcvQ1YeVEfCT2ΨR:)?1T2)Բ *״h u~{˖-[^vDFr饜t!?,?KdQrbh D\]BE`3?*, f.kHy2Jr2tU b3*%뙿kk]^3?z BY ظi?̏ꔡe?`d?ỏ83`ŋ?Ƙu^C[Z3VA7KіK#wR^?اņAZ?ʢ ?ռ?\ir??a$2"?Vf׿`^8`|?Nfop8js'ڽnBx#=1egbq{Pa؅5?tOZe? R_*5ݗnmJKl*\6A?ɢ$@JKrǞm|c?N>lOoGq-?Mkv|s{ۮ?o{n_u` ^I< MkSQtd㻞Ƥsi 9֒+/wu&lɄ2??f4LpqٴQi(bC???M1' UIM?+&U4yLCZ?$WE*Ń?P2??#16yQl*-|ᑽ{ܛ?cMŢR???+#BCBV`?枑^T#Ç# ? HSx$9.űimh.<0;-pIA?x?vbXBnwϬH0{w6ie~596l/0矅Uz?Z~:\C[}\?{znfRϞi=pnOܽ^]hkXje^e3jVQ ꂮtu&g Y-g?M2!<)FybҊǒ?9nϕy6)T=)RV@k|@RrVJit gNd4Ne cVl?9Obk?Y.jkn-Փ2Lg\/"P-P?d?Gw9WM`2ErU 3Q|wjTJXkbC?*0{frp? K lܕaf>QҺPB_Sme"p'z,gR@+Ͱ?n? mCQ?zM>p@ _}^qw6Ŧ+F_?.7k;O`??vOF_v? A_k|~Z?IK@kEjiN G [۷G~rT8I3JƐ-Xcur rH sA?AQdfc`>BB@R)P HڊjQa5KeE\~+V2c 8Q!SXwd?: bv}k?0[?gڶo66ٳ=ï}fops|dYODZǷ?Kyl׈;=kğ>8 GSo8^#Kjq( E楈O?ZRR ?c=v B$}HaXo?O[gٸxt|jnBZaiٹo~ [!?T^ ]@NKk?]+ )@TF @uI j˰RDMHCBQ@݆}"7Q4aXou'I??^7e??EʋHSv3fCAºkAhw?E V~ ( ϫGs hcT$sB9p(NYgbc LtzƟ]άv6h? 3}6ꚏI$rqےBķ_W CӜg#7"?Bb La+20f8??|]8Hbǣ Ih ? D ?#"Z`ej\o?o?m|?|<'u3Aceg|tJPNUQH|Ve?f3"ҵ*d3?]bV?A_w?C' `WVNA=+rmW: b>]B :?T!_ʕQBB?Fg %4?b{P]FrX)Cg1 FM ?luXc??Ec?r,xY]5]kj}÷J?f(5ͷoUTKjb֭vcGP.c s u[F?:]PwgȰfU!ml?xl% dxT,NROMIs ?|?;W][W>}tN{ra}_}͟?kno24v酾[k?WSH?U S$.R䠏 f 1j2.+F6@m#KmppplPI'@ɔHjo೜J`s:Vd,PA,A@`J1_犹l1]* x'1wt~:(,?άIh?l"o{Ι?[{S|,"X1.B5Dv?F H' ٠|^ö-R?i8S兝DJHC_Us+:Ic5޾rm!\sb'i?` zWc*J.CABZH<o"[Im;g7Wa~?_tZ??֟0p,3?`(1v E&+]W? p-F%1Tu?R#~joXH@5Ŀw3`+طkyu7vn~~ \Q?אXNbͷ:˃TWM `A? e(sKYᐤJ joI0#^3*?5I| Gc ,QƇ}w?>?C.i?{???NES$5!k.,icvs OVDw?**hmh #H}a~1NrhQsvAWb~jL㽾jt]D0}֏i*`?!9Xgo o+Xp:tixn 1@?+(<c b\Y$~%QfeE?QFlPcH|oZZwy?GTRvogNbQ2?xѧO;UJ.&3q+@k1oFBHHn}~@[23j:6?]bxRrD>Q@g-G-S/h? }PZ5PD??QFs֤B=VNkZ- lkl?s;l?x A^;|FLxђuXR,B,d3LMCEirPV[| մ noػy?9--fP2͡b:Sjq- 99TH jWQ7 bS!IxeNd]x\]Qg?RZRET(&q'`.9c0沽>𮽇fٝkv=]/D??Ag mHWwxgv}>@u{md\N3it_tAsa%.}vlf=ńh?Mi:r*_[v??~Q-^UjVx??^i:vftǪvO4lk?qtywu1 w:fGN?uPT=W;;Ԭh2o41NQ:7Nj:?"OR ^VET+?O$L?&WP8Bf<M|$ΓIs6k4M T??x&N $@?<izxac`۷ a',Ip*??pwQaN?!?7 ?Q&Kla\f(&HKE?EP!LU`L}{PԭS:]YCΩm{?mAB~y nVZvHOzj?ǺMVݷW߯Hyrhݖ-wSMtGm;LZgIM1Qzc Xo4`Ct2&y d_0a>7̳~q?њu 􈏲'WN D\, ?ĀUjVE{ l hg`Ч9NB]yhlN?'ܼӼ,*?ZiYY^DyTipY??1?L ??'Af~Q?L? @p$ ^߉8r띾k?BSNX@k\8-&%?MPs?Yu\hlQ}?UP]Xko֝ܫԫPQpbʮf3"p0\>%\tubժU?ങ 9i!'Pb>UȧZqΔ2TDW?%?%??? hR\@P ?Hk?*Z? eħLiCB'P}??W+Z @uR.JkL?ifX* \*yFdBƖްOy7]V;1?m?n@mӦCHMb'hCc'>d|Dؕ%[ږ?밨"CX?w{D}KKYZ`ggvv1]kx?Y?P <D|^FH?KYt??X;?͜?07?عT=]>Ҁ?F?zm:'?[??Yo]!cdVO⦛xk]}%AQGA7l1GXZLj KBs ?IZ$I6+?xBkMJ\KPIq^%b #Mf D"kYey?u֊aR"D N0"?4yϞ[ Y+J8 '`fJ0 9KP X9rEe,G4?X$KT(D>B?Ų<`? O6\t2ެ7u7\2]h|vO?j~Q˭ct'LGf?onfk&%hWG_m>RY7?ZLA Dd\Mi(ث?,:[V>NdUȣj""dRd&tJfSu`p.SҏɄO2ӆ8OBrEަ N'??l4 1?&1EZ2?YϨ|qv-r+b n SGcc?Տןv^[}?mtˇA=I0614E2k?ej*5B`xZ6}?F?ZWQgEp~2<_ű^$?EYֆqF+P~J\4;+10[kaC ed)(~-BxbtÌsY?|D?XC6"x=s`||ѩȹ}=c޲\zq(}>:jzymG[s肎02^d4Ytzol^;~~β BjF??L ?4&ѸY <CIQ|*$E4ȦTV9+h]Zc?9/^3F€MKo¾&|TGig&uKoZC;c{߭??^i✍|?A Ɏǒ[{Nn}G?|?fOu4?[?nA|?K;"E6p#B\Bװ/fA餘QlI ٌV3 ӓ|?|,MjnhCZKs)u~e 9s+VV?t-sZJq?Ԁ -եr9Ʈ WE UuZo@B?A(*X \-5cQ~]6[6!j(EkkdEEYif`?{h[Wnݩօk?bp|A2/A>3Bז D PE4Q\?Ho^`o8԰U X n<=DMSѣR?K1W(?h$9j` !5[?)W+Nb??BEQ?i^ hAbōcFxmʼnHe9e-孲%[ʒ]2EHq?!9g_?j^zi{JzΡ@<| ə!~/0K ͫkN*6 ]^Gӊىxˡp7 B3!2?,? Qx&̸{VYQ?zzQqvW]c?E"~?#XIÓgnvxl饆j-wjOڰ@Wq^Ikp?Q=g?+ dJaյ???8/*lRţ<8g!}J?$D?)CXh/k:\)i4zMD?Hފ ̉H@hHhaxBWJf?%pdfH N;uQHn?G}^*!$hy?^ [b?un?kk>6_}dOf[///w?Yz=:.-ݩ\9y墳CϾ<8g=?qƓ+YhV-DO?"JM__awc5o?kѩӿ}o賩Hô?P3?zATȥS9Dt!k֌lKCj?cgDZE@uVIŒ\\j>0*yä50\d5?:9pY8ϼ§SriDHE,hhj~=rΪZF?i#A?K RFNa?,Cg??ì?d`QXOO_IaqaUns䶋! PgfJp2i%EmdL͝Ris}cn> :<NO`?]q?spJSG:zzQ]?PGX@?VUTTwo>h& ?^gf,:0Qͫ)VY?L.^ ͜ XzX_/3ydp?|l??L? I/3; ?!miZZ|4\i e'%8˭UKȁ<?u jz)[*xT[G}B*AUp칄6?v?ww?o~}?q?qCױ>cc0?ҙh>qW槩pXŦIX9Om Y?tpr9uno~kտn}_XTUi JMhۥToiIƆ+{?ߏ AZnM?M糩B>UЪP!]<],s%k/ +ˮF(KF{uvqk&*vqgjs}-?$H{ɝN/P@]Θ,$.PvҋTrTFw{9~Xq=b}Ekׄ1L%MИCDEyIveWEׄ7/  ]D?/U`:u:ĉ1HL /uuǖMB<}H*VPQSB jP6ްx{f?}̝?K?Mڨ}JR3gs?N.??Kwފ-???bӹJqZ,T}oW? C}ؽ<ׇyne?vŵᓑP$? (Xl1{"\IЩ n7ޞ>ضPXk8FT8&qY0{20MS<|o'?O^qlsoF? /0hdct3"`5?i􊃱?/I`MP ?ZR~!c$]HsSe?|JTrU- BF,'lNrJ蔚?NR IA-A?YlADUٝ?ٽ7~r̬Ңs8 a?>h/+S)RPXQ ")! ͸ƆB\r|4r$#%hqqrڈpD??'z"yrgn7ߙ;pbőpg6?Ϗ·6_U`yȍśgg:lm\P_?s?z?jpoysCgF?nSKɁɅ4G׽m?K&zJvV>_}{E< }?O˥ZqQ-B0,o"ĖQetD˛e\f\]BQ%ZW\FecWn]r+ߊZUk6XCR=U /seTA2DVK%ҙDdW8HԔ@?S)Gad??q.t?[۔ w2{ɻDD[cTs]?}ܒ"S>i=woGbDb%?un?زew|^r@ftN6t;/3'?٢fhވ@3>4^罴7t< mM|}E{)1ǧb?"|\Q?R4Ls&l Z\[WR^4I*ɰ W"1?G)IY?1?6CLw'??Ocuo?X?EXe{^ 4c?!baȰ?Y#$ΙsF&_`gF?`qZG?jw{v|k;Pu`[a{?t??)lY?cwN-vL$t_~[GǦn59cn|?IxNdVlcqK~)'K>*I?,h`?j&z$IH*nb3d2~oM$P5?P??*h^3XuCP:SSdCDh&?_Wۯw_ٻ|kd%?N2đŬm3ݺuk{ UB?jt>΢?ӐW gٵZ-"`E+76ƶERPB{Xr Jy rEjP?8-VR?KW7!n֖  *F߬iFn犥"q/W_Y/ZZr?QPnB-CwĶqq?ZR$0>4Ab$M?8Sv䨎bɖ7I?˒b[h%[?&wp69pIQ?Ez(K?rRpR)W銀mam-ի{bA ֓g@j En.5` D$q%j}} !2U>BUk??W0 v?w,G&V ^| uxm+g-@d)p,DZD\@nA if&]MM]K>NL~agXgiKXgQ>h[}? tᣗM.S{`?<s 5:96+iUJ IѲI u?ET "͒²?˚*i Tq?IqJ</?~FkqD3<Di!K ?赐Öv`8`gXb?J[?}Ã{?a;Gg.\:6p7b ~u}skE~MYkAs?4{gᭉ&gٷ/>3JS?Brk}?L-E]w|fr-Mp"Kfz#?CL fڝsc}b"J/djO pW`rrP.]?bfBӕ[O?9/W֋Rˉ?V7J&I!St1yV˪T>?TcZ ꯸jΗK@qZH6HU?y?18lkGH;q :?A\%.T`lDj\mnGgs.ctoDテ*?I*&?Y?q㉸GdW>?Қj& X=zF{u*F?Ŝ??J/:my?vjv?8XavhH _n]L>̴~=/B(?w{IgMJ(iA?HYW̒U9FX?u!m!-ckVj?B̵}O윮 SgTFN#KKO cl^{?iAk{ `9hNeqy˼@Ri& zqOր҈ըqZrf݇ ? \$FN?{<0q*Dz?`hݷfF .?pc7ƘlAH'd36z{|xmgdh:/ެ_m748nn_??4yK,ždB#?9oB$UUVhQRR4bRBQ!dNaV XDh AfTSGrRkגBQC?)A!O? ˺?eb#,`d,53/O^R׋{mW|Ez-%faVŌ*$=2ӻyv?Yȩ\v}M+E `zP?JRh?Yb] B]-Zh]J%@5dxR*%ZVݨUHݕVUBf7K؛NĠ/u5v\EWJժVU+l .[nn6! !] @8BALB5dxlg<؞Ev2 GUUZUGy]zٱ~^A^G~B'ȍd :?8, gb'?Gmڴ)Jϑuq d;r녀CcH?K AcϘRH%H+Dk$mj{':?YrO .lSJoon qN{FzHl2:1? ֨Җʮ?֫/OPh?8V⌌{@z[,Mϒq2ɲl<SeK`aܗ?}][Nl|.v^W$.u65Ib?yjo_=ЍwN=j.s_| 5~_k1}.g9c̴n?2&(Z~?ff\JV xDMO *b,UAߩU-h,|i#IZj V,p~ J@Q38IStxR?knڸqʪ )ū ? t06^N_v Ԕ"%!Z':$?(??9nho  qIEEs? `O=w^C)Gtg~_7vԁ[:q`ko۝,>xwo5onh;Ty`bcwWs҉[Oo04茆ǩ?sjڡYyjw/qjDAl)kB?m!c-e h..Q?}O[*o&|*o??\.*:ALՕC|J(~!Ufe5?V,K?\SP9 FgYʒ.y3SQb}?ߺcz"wrj "s?6brX ̯0Tʦ UuvuZ[{bآ>y^@VWmZ WCeοj!IaTLѵ٥i- ip=_Z?ί FFL˗, d 3NSrBr$E?n>ޕ\cBVNOU:Y?_gșXwRm,8?(\fv{>~cfWC,Ŝ>??dIuqN?򓲭o?_Ӄ Um4J6d#(lz3f4Җ4?n?r7s̰ ڶ;rLwQ?xv_p?h19XBmON?KߚZF y=׼je$ GsyK׭ՔD&:FD_20)Q~UT,XXѠAkS7ͅEDMQ6 z??nGK &?1P?8jFtu?7}95?ļI2$֐UN.CF?WWIL L_*XI5'O\bq?Y1Bn??$ ܜk?pT{Դx]=Zի p3zC3̪6Bae@HFV&-?ciG҆~6,8aGs4?iۮi?ez4PRP#%LL\?<|??138I'KS* pM ZN#'gl|:~i  CC~jif2αPvFuFʠ{h=qKL%?z/SPGt+w%+jFQbH*??RL1?5 ƦGK8Ō0s1??zhc=G m KU%Tu@ M?o?6LfS2?>DPu{on^us%4 phmie($m 6??f^O/Cd?f?]gm]e O ?20eN)?IJfMƮ$؉N?%^cٖ-Kdt}dy?ْfځsѹWm c?@N#Zg3?Bv[瑮7Bn};s46Buv-no@! R@5˜ΡQl`鲫w_?$P9vT.W4֫%:w᜿vzٳg|lɼ ME :*:PY)oF~.Q16KzM,"G:u*Q*OAB1yTr9  K]']liὕcr? {??Xtµ)εB?y'{f̟7ۜMK?k̽?b4brX-?;F|~/}o<>ݳh\|ә˽0>ُ-c! 41cA?E'd?=1gz!? .1W s!\@F}0 NI*?V'?'Dmr,Z.Tq!RD 'N Aa]iNg%?CcxӕUͮ?%I ^$A,?iBi?y8cQ|eH {?'qE1?&A `FhIZӂ?r ϙ{_h?]:?wS!,L=iܾ|W~c= ZTuٙwW$?Z?qrT\v?V?~nm`eˣKs77[3ӭ':؇?U-^<0qj'~xo}mf[LѪ . ರN LDfVFc"HBST)..s?DTc.Z?"Rn3k4ppf5 QNBh2r< $[XNP*KBv}Kl&iyV}ZO ĪȐd2$jv-RbPBl'm?(zFnt #Kr֭ GNF1X?,wi ?xYmwwP]U~;_?T@1s|n3j?UdO EU )4tg\tQH&,$?Z;㏯D F"⓷qx;R~?s?u6q*_;sWF@wӫojP5>~v?U{=_ʋ_ᗫ?:0M{A^ȟWW?iNP?lliI͝V~|th?j ?q5p{`qX{J\;;QA_wCOm"I4tNa?$?>%JulyD?/[xIp9PP~vl wn.Ţ2f6!UtXI#Dt[?}kj~аzVӥwBv u[0eQ?re^a}ha_`]dbrx?g?{ox?Taz78ӎ/R7_]sш9?y_xd@OR!q c?fkd81V.lܭq~\쟟OCF͓ƾfK@kSTő#{u?W@? H&*窤*`@А?QiՈhP WJӰ~֒HZ*VURAE??ѰkuƉP B9sha `[e`g?. 6ZF-'3I# j@?v ]F5? 3ҵp iYߦP?]ka$fu[֎zέ?wƱ(nf?#Axl?l?.88}=MQ$x16 ?@EZYY`d̓ )?C%MTLŧxxĝ@?i u\DPxlxNÿ^eyP$},MEH٧캵bo5_Z"?>shÓ\9ܻ=PbU+E}XUÒQWD??lB.N$X6$?H8966{lo3= HKl?ξuOa>2T'1>PiYYYkdY )[H@x: ??'iCr˙dܲL: %f`ZKTBg3R!A lh ]?xU6vnM?JVA!ePJII]vamq z?4'N_]]}-M?krzfh?}]:2J\?غ_N?/_?/^+BQ.R \޺~ ~<:\i8pΕv]ovlNV pC1pi߇kܘTkN~kMOl.=`wI?"AP RVnam-ee?b}[gZ?*ڝONmؗr M٦V!m7hscgu ՗ǯTNVͮͮ??u;hlxx?5΢+e`{P Gl?JaFl?GqX&I?RH??Ss??o7oްaӸFգ BF/; `?pWT(8R1HI?]hGeH;;FX OaXp4IaMYݹ?S#=.cN1zϤyImȨqkia?GvM[:A S^Nn`kCu×˕v>GӪKkǿP6_mᱛ{G*?uB{F}?oFzkjkw jNqծ?"?WIP3~?0MC!l :贴`)Ub !.R1i)^LAZ?.?iQJ҄`Q J?DxMIυB)i!EC.ؔ$|JdӅ\XdM/).ʄI?:MpdN%QÆj92Zȯra1YRs:1-e%1ip{6 K ^\-J腌?%D)m]EkJ^+[ae]@NZF{2QZS? V,e6xV?r~?Dz uOj psÄ?`v W?"s[*Z|UbjۯU?L2۰z?v Cӟl\]lwX;+]ʛ~?Byqo斯]G?GOjozһw*$:cK#l- Nrhl?)fNC.Ӿ^A_w>؉uU-ZÝ=r?_ٺϸJ6}h ?NHSy?f uFHC݄Q?w VnP܍q??h{[[*D&gȘj{nsl50Su OH ҦexE?pH {y?z^h7Ajm&ece??7{Til;lWެ4lUG /k*/ca' By 1|(Ѓ``(hFtF^,?S>OX ?W9aDYMؐ!?E8lKFlN@0H?l@~Tx ?aq&3(EzI~hi_vwjv?p?Q ?^?^H&x?螚#1g? 9 R$$BrL&IQ? $y(Ҿ*MJ+cA%O&hTx  #~3=9iC^9=}VuͧinG53gj }GUϵWԏw_xf_ v(\CC?M??lT`CĊК@acs?^uY⑥-*"HCa8?/OPeD6*B݄??]Mw?Bԩi7C0nR^  ERB[ T$;!v?g;ߝ_ȋ?N?iҴU{.I鹗;}>*??}uwoeSۇk:Np|b%Bv",35qefr?9$ϫOm߾?>#%J"TҨ饜U 2vVm_dTf@ګKej*z5_\]rqe Ir^)W2Pl}kk+e\Vܢkcäi^^+?+Ȣev0f*յ-H#<7ʕªm]Y&;>|͍*?7TTUWБ ?AUU?nkZxSx#uP)l DYAFYB[ϸGCŝfSSAr;0 ^H0?tujYTqZX?y[ ?⬳?1y?S?a&PA??&1ǨcNo?w&Fa)~֯?fZwު]:QE 3 GX(I ZBSm k֋?:[N)?@oRٲ1iHIUp yr$SL2eIKi(?+luD RJFYdRWSh, ??Q^4iNSiȉ?o?p<? ?GTNpGA?}X 8 V "pDh- @k??S26"T gA\q?Yݻ>Zc9DarȒ8T)ʅbqPZ-0 EATY۲4zQM!?>jTˀ?LЩM?ddZ.Bw{E5muB%e|ڑE?L+WPd J\T8I+E?ٛxX)hLc]P [#[?m zvfnC?~pv]v񨧣qwWͯ[.av2c??d[ol?]Ýo?m~x)!),ź{:G+u蟭f/?:RE5|FKw6~(oDK UT{iUVjV]@[(P @KDI . Ionqb'$/~c'?qTꪭR_ZL"[{?E\YUQQC9Q?֊&pNa?H[s\-]C.+aMA M_?G5gi>훫?ZU.??n8d춗hBNVq?ظqckKdR2gS]=??Ņt0?TEkylu)oj uZhmŕRaT,!-iK 2vt]*/HKJ{zKE|%KKgϭ e i?i#B?={_[`~ b7oF0og?։'Y}azkg^G5?auiG/# ϣ<v(孖a?V{n ̠aU|Aq>ɞ6bv9X?lTX)X?"3?ƫ~M?mN΄;h6qޛDb5H+SJ?{W6~4:fI*F'#I?;aXǃ@W{ 늷"?8aA:4x  &m=dk}p5a?fUz΅wIFTUNU10cS*<j<nS,JIgTUyJe?UY9??%)%Ҽ"ۨ'$@r>cՒY"o?^?s ݫG!ɜ 1PZ ~PVtvwK|BZҊ,?ZSM*UDk@5aj )a:mqj( Лʤ`.=Cl8 ?q6AfF{cu?q-4'ܜT?fxM"g׵lh#k"NkԳ56goCv{<& ,u^?Vx֖Ӿ uuD*)1qJacCLbl @f? Ēha IFB?3h4Kֳ>YPv#Sݯ=?Oks.BRv h» Z7AU]CT\ @_#ݣ?mg6rbK֜:$G8j{? /?d?Eoݺn]5u,tz"xscj?c?GeyFx?]_l:}s2?}vkɑ4xvǽGn{oA,-?aD2Ex"DAKNY2C񐙹띶{G\͂ijJC^?N* Mb8ܫ^OYIDxLelRmDkMu-?YQ?JV$P49QtMjߵ{0^?׽?x^ }@bFPXQIȪc;6ojyc ?,JᢼXd)?kJ(xMTW+'CqHye6Yde$jZEك FoQ~?սM`:ae޽θkzMͫ>[ִknT8lr4F<Ƿx?].9`XlY gjpE^PA{yty[xp惕HsCS77?;'Xo_? @˾I KTTȕ?T8Bb6b,U*?f^)Uuy](!;ScJٜHz?rzE[h|\.q'l֤Us -& d8"? Zt\-^|?̤e\-MY>^@^@l?`rHs YZ2\???$Y?t'| QSbh-%J?ay@Dz6=iY?qwPr??D1;Iw1X3[[e=;SuSu=߹c͛=_3^!z[~9Wqp` W mGM|0b |Yyi)i[–3ƨ@ ;?7:׶Z6}{?ni"N?~>4D?Gn/zw?=6d ],QxNGy@В~GS?uL;Eߧ Lxܧi>mXˡu?yIH?r׮e"bANN(֒Դ%d;i/jI$j9B~`/30j2 SY=Uu2hYYJ}qvRR讷(??}h#? "IU0B/)TNhH56 1fc.6^llK|]\vvfgvzk{חJշK3U?gF3{?;̔B>*cيB,z;GBФxsNdUOjnFz/XNN4u?t2Yu\ϯ::cuvuAx}5[hD]=ERi?rӃ@"c?c ICm)eP?ttTPLHd?ԴU$Tg?ՄRdmf: #T?l8)dє|,m#ZkNFomcjTm ULh-StDk5?|c*0h?ugk? ^x㰄J&??^ۻ;XwsV>!|h],df3%u??sz? ]?pu\/Ab,F٭PdlW+ j_,U$jRE\Z///?!fE "r5T ]Sju?VnH?+jz\."i ?@zeK ښNo/ K.-t s*Uw5ty?wʢKV+_>VwUIxTp8)VW]\^X9.'1=?OHxH)=a?lj]r???|r???iסH9DQ~:?C>=1Vh ZȽ(C0? ??! x⏿zkX۵`t#BR?Zb{]t$L,*ӜeQCuN g&.?|PR UtnS!O,y9B ޤ. tn`D?%?Jd¶c  THPkBE?n0_ dZ`iI V vnJ?h"Q?AqhVU[P ?lxbZ,g/!j?p} dp ?xW3?/k+t(L@KkCB?? IJu?siZކKo??~~@Kf.ݝأ a*PD9*R?t݈n@]^~\nԍ}|h_hqu{}j?2MP4&6MK$IUNȬ:㉴;?KE5!_ }zx?G_{pމlnZ  EjdĄoLF7WySK!'ᔕ_(f?|lh?WD?7W(J (e%O>Ty_\o v|F*lI%t?r!mb.d L -P.3?5ۨJD(=1r~t?푊v %?7%HU(եr ]| ?QD dȜI?Уrequ\rq_aD;,MY"ۑai?|z ?ŜrR]oQSq`@sqfȜ4/8HsO_۴g|zz?ې?amQƏ_a2v? 4l?pf̯lޓ\jkTC?:݄5:ߌ8HpS?V?Jr̐2PYhZ&fPRߩ? X?y _ {vc= {boڷ?On'5CoGdwrK;d?IM,t0l?dל<3i t? 3N3̄QEI?ܸ^rY2-:;VZgPC+gc;ĩDӞG7 ~=qi;HSO`)үpݒº$@Vi_N}?fc1ȉu4?3?}؉ޜd ӊ.'wM??x>CZo, CAS nRmݴM^@IiĮ8M%_YER$$KúEY")^H^.?DJ%KQ?g>hv?r?@Yo?z +?yOAQYeZWErm3]Su8puUT4RHږjOҁ֦ 0?AEW`sC&g08bjj?a?7A7 i?{X?%*|Q?C)ф,i jc#fau pp??4Ӏ#t?ao6%Iٶ?W?9Rc5DNDgU:%đ 4a?Nf *.?>ɨ n$Sn"6{bwl6y\F%UA??E$ESM?lp2??DOb6Xb^pJ"Wb _ʩHP+h`]~K.'Pbpe` i) ww=??vF?^nsO?c4tu1|&ogkx| 94Z^?YI,#0'hم$???/ȅ/?J? M?n?$p8CR,š?I?(K3 o޹sDJd d !\?䧽Eri>K@Ns.WdbؓayDʠkh#Ij:? i%e/hPHBI]Z vE:^}J_kQ7g;GFӸϙv>L][:hw9?K1"Rt_hg"R2?C/?qhB;+OxzO6k;k[کoF{Ăt*ѱo*!?G/ton Nl><炕=pllOpKnFoz(Kb9G}?뙔wqb癶ԂSq?VŲ?гV,Kb *KTr dG&6sSH56t\#9"sca+jA/͵YlR|uch%\)oM0;Zo#3o"6lUbqmT*m?ZC=(j[ҕ i?PiZ.?m=ڄg?_@IYT>MHdH%^𸞎 3J?T+/C_{mu3ffrİ:ތ)n+x3y᫽鼼?h~f|ᕕK?:iHv??^džK\m寿쎯=~_ѫӗMtw:F澥نx?C{W Ӽ`S $ i4PCقiAk+?ӧ2IB]T?vTBM9ȡpvNDH t wMs/?ö?` ]>gW~o?cI#/?{VIJ2uE<|kQ"5tmu<^,UiX?1v?v? (y:k׮Mt\Mj ?\c<L*JpZo~|?}#ϸ+|q]n|pcIut_hc^M?v;MQJxa=6fJa]'MW=ljy??.\?a?>iңV[ϱś1\s7>5-$!s@?Mq eR?? ĩH˼& 0[ަ2R??:K`f0?*iNJ҂ԋ[Ue?'Ct6$9NIya2#JgR׮WT?H)A ?jaJ :a?Gq"I?22Z?IZ`хzP@@gA"Z?Ϧ9$zIǚM]8gx?}??4hmr;-ߛn~w}3ߛ죷͖^~Q~.tn_kt?Zb_zwߑ4 ?˭'.Z{lSޱDh?d~OͶˎ[m1e:??}O_8:y/+gVlw#?"al|u_?ER^eB\"Ĥr2̛bs2`Reѐvݗ=WC1S*uta}r9 vp?(r'iv,2.H`YȮMFT]E+BA SyM.ňl?{.j[(*E T?ެ\,guM5X,UkoB Y,C gKYSKRuc^ˬkzims+K"0-1o7q> hl]?IǵV#SȮoV6z [<pTJI?fχ}e=Kw/{9zyZs |u?6q*]B}`>F?Տ^~˧:|t?aτ6}_:[??xBtG) ? ?sDk?5zwxhj?̸?gg{Ҿ9?G>Kxr=~^y[z/OotJi}!Zr`^Jo늅٤E? `??NguT I¢|tYlp pml}H(AP8Nn'։/ŎVS?Eɒ-)ho.]K?{pyoR}i pvvvW\7L//z~sK/mپGOLH@Έ֨d\Fe>t Yl`҆MGww?QQ}i?WBԭ}m|?>_{^"?#ǂð?<~ o߲wtG(wܝ"Hiq(?|kؘ G\T~?aO8?FވR/?&I`qHYf?CaN??mڄ?HEN9i2?XZtA?Z?g RZ?D-+*>? QGT͂xs2"(Pb?c|?x.p<\+))<$E՘Ўq?MR> 癎H0rDPH?_WCGDk%-2ehJ&7Qheuڐ`|Ld1mM̪VF;Hz l<$8i?:z\Y?,s1&"D|ɹc6?ee"6N5?bJc#G`\???? ˢ/Vh, nO3Tx2X f F ?W`Hi09Au5p:%?AJ%EA?F}SdL?OG,d!:)gbsz۶ T#k(B|FR:+rP|A^Jż\D.C]TՀjZ+T]PKr ]摱ӠhhKjiV^WJn@t?Qjz  kTHPAڰԠ#T#o7` nR y%̟.VʫjRYYZK<R+UecJ W)/tT,?ep?,Nso.? p^Kڼ(M"?Ο? ? gA@6VQX5P7?rd~A,4ʫz-#+Ֆou(ᴹqoƇyM\8߄xNĊ[XQV*?% 2ˊPd, H@\-?l:OE]?_ q䁲=$\=_}]_]y"쿾wjv>:k cۯ߲ywkয়w]`>LwgG CU\ Sv<ɬpj9FLQ9?j}?\wckTo]nf?t9?3Ng|2N]oMdg*>iW궴UV}اJV,Zu$V[`rB@$6 $&wCnN;vb׹3Ǟ?v.N_T>}w&FΜOf"?dDgD??ja燘lJIH?^Z?XZ\>Zos7LȈ~p1@<ܕd¡ʅ#J? *sDCkp?[Lqr>~8l;6|x~*c? 6Fұg ? %!I+k:V?R?Ϗ|sdWqdmik4?{؇hOkWt/>;JG ɽoONAr"?@ת*:J`\FڄQ$=i&hF KKMN?eE̋tdg(A M/j˔Lą$? 󃽴k"}x]g)Bdr5Y˺^HSzyjDV R4 tm ?skś7֜;*x#ab6|vޙ~x!j)2ҁ dq3?G{iqM@jIT]s46?yVRsgD腊ٴ?Qͦ>8Q U`_sMIdURTbǒQ%r9 )Z?hZC{E,At"AQO ,? ,biIPD2,?|IWOs׿J?UH80?5@ljJѐ lhˆZ4 cHԅZ?-?Dk@uR\_- @Vի?/m0\Z&?ВJb\׫PuZ)?j0uY6jRע[pEUy 6,r&LȾ}/]F@u+)\S[9,mtSCu맶Un MQۮZHhm NU-h?KW?EH׻oTEgw^m}QFq _?RRj4 NB?'7UK] Sq*?N?G᱑r9MNr3?lȝ[O O&{θ[ _=|}x?+? ŰZ??Pyzby`|:gqS_r+xgfDBkFC1t\)<ަX|.?5$9y0ˡKjHs jضm;o?c;0?{pv=pW7gK?%)"?L |s;^J&~??[LfJXd?W9j? -ɻ{?B{Aӻþ?wL<9Fv~?Dp?=[Gy? h`@*Q%?Dex \V%Iez*h>h:}dRPmMwș??qyYv?vvtYzv)n{Z !^~[k~8?s]͌kg0> _<=-T|%Q;=gQ.\1OQ(?QCVdN$ÏrCoBDy0ZN>D"Bh?k?A̝qCcG}CÏNw?7u!a?–ў@aq?rr?c fS1@3?STn6JFBcp 6 R2"|bOGfmf?IH< FS'w~:3OXAFHİs^qbRYHrp,c?+`?{1gAWpbji?nX?,nӓ~ĔktjblgJGuwCG ?~o?mŎ['[IKk!YESbVWr9.ϧU( QbF_Bcә\&ӖB0W@\qa^拋 ?sbii Q/"H/WBBZF?}K+ePRye ւTAe@)Z3 ޕK?oӳr}]BkajmZhu֌iJm VV^U֫UTPZb|Ak_?%cݸQocJU. k? jZ)pXVʥb2 p?8q9~A8v/ Px4}qsہ|=ކ]5ntv F( 1L4ɲg:{鴥l?} 8sxJ8{6h G4=tOu3\}gzgm>G/M?onYcKaMD6.u9Ak PL4DojMXT?EEMHBol@j:GbhRu?M\xʦMu kz0,!q? , ,`VVcU ldB P _X$\P +=k??pHp"dƚsg#?Ǟnl?".{ m%{K H2"7xRLb")I: o0"#OT4TU?}!S+woկG?^N '9*Q,3Dsa!gQ, MdWWrɧqoOƜ?A ЉwYF"?!??ګФFd? ) RrV?Tiwa:˃B5˳z"&?ACp?z^[]Q)\?λlk*1 2?6jQAU/yRJ?QIQՠIFBqcIBShr1.x}k޼^\vvgwR#mJLss?̜ϟ9:&; ?]1|ʃ^?@P2@yIPp:?4RQS֛?NcТE[A!?sE?l#??j0lmmݵk(?\@Ŀ Lxرc[l9xr6JH WY2q׿m۶( "HI%^DXeCiHQ?dEJ ]g Kc P$YeY?@P%])b1eS,KEV,ŠR&Ed?rfMƊ+5TBZYjlH W6hTYQ zF3?J\(@ژEbhnNxfR!gC%X&S.d(NJT 3K.*c?? X1O?sҡYrq:KXjȮyLK$/xG?1Ry ,|?Q\1Y]??Æ*)*:?VUWT^M X*gcvww} ;v\rVmv-ɜefiGщK'KM_j:򽣓c?ӱwfNga??a:5d΋?3u]7~nsm?y[?_杳:ka=kOmv:x?xyJ}>Þ[ёqKZ_8s?wMOP`ѥp,FH8 ?BJ,d` G 0?s{rcqȃ?@8A,ZZ/ό=k?@__ ^z/C?1mǦv CX?b?F9Nxt a?Tv–qer2C?^ {C!E0" 0;\0ۙWG>ñk?7o͎ :ΩGu<5?k?|>O0qC?S@_Ŏko7u|x`߽'O xֶ|wL,Hbs_\z̽?[]q_x.rȷn~C?I۠hIˇS#h{m;։;nz}gM?̜{fh"рo1HqNS@xM/'Llp* ?Nfp:cd?P$??h9 OB`A ?\nԺ ۶Yfj޽{aD}ƍQ a#?QqHHbb"j!n|pdXbō7Pq_ j Z`E ?C-իÊ?DOOϸ??V PVV?Qka;=ZfͶmP a#?zyy)?o?PP( R=x ĠV8mڴ۷ovF#p P q|}}[[[Q ?$//boZZǏQb;dffajcI[Uoo/aƍkoo??***99ұ+Wdc|wEzpVQ](nׯ_wttL5++ 7 !!{ `tttɒ%e]w`|X˫:qj̾V8[n^C7,Wb*%ŪTzJTbJưطsv Pbj ScV1kTao/>NZ ?yXR??`*??t U+]?Ƙ*fjZʔjnz?{^8KF1gb?p悒TLsxI摸å K vj5?}?lVVd)/If'iSVh2j?*+^|dGɱ]Ueڬui|sN:v"Te)89^YQsr_? ?WWyf?cIIF?yY;(7gb?U%:K}|0{m?ASyqo ?jO?N4T? 5 FUz]qҔOkJ}UMƆO6dCtlRB_o?!!.^۸:5UQ_Q7l֯;u*k}|˹m緝_}ӭm}.ftd_h=mOwxiu_@\D^# ߞ_OmY??lyw]٭VRI;&@L?-@F3# 6??ȾOj~woPbϥˑ^p?=?hmy?}tD#Ȥ2lP*C_yZtɠL.|4L?^&L.R9XAYwz);RRsѳ!2NO%OPE|N_WO\?PWr9_wIG܊Φm{x{uVpxz^Yk_#Au.C|/r }}Oya]AgG?N? I?ېV\? o%}t >wlW\ٳy?h]]_`1KȧLs^}6HeP z?.?za?B]ވ*{;xHGY ~wNHL04Z~  d^$IA ]@?0'ł7`gKDMJ^b(1vQj7c1 I|CҰE@L0fy fJ?P.?]wd@Bx\AfbJS,KEi:p9KiT,wBiE?U% ،l?Wpb4;Ӈwà/-?\npgkIx?{ntw\,)??kWh'9$-)`!ڦ NPyJι9ZmKz5!Pf!wd( ?ͽ?`1sқ[qur?ak?b7=FGvՁ{gj?\LrTo _v߻??oLvţ}tʙ:{[? 峐|R( ?\FpdL:I fs4?@Plx٧ʗDStTQA4M1?YX:LX&8{p?Ջ},%'WsN?e{p!:bWnǶ`[WRpt*Uc;?Cˡ ElԩiWkiM\]k?O?ZK¤qn`??L9iAa\zi7?ux?4twQ86Y+?u]|_OZqB\NS,X7?7-7|e?qsIUmY˗Le&&G/*sz˿FB S(jbm Dvs* 1?{|vp k4Gn.meىCd Uw_g6(WRw-.%lZK ?ّDost?e^oZ? A?A %ƶ[v_t9o9µXnĞyR?Ű:g֓KH]>ps HfrAvEd TBQ.5JC,JŨT Ud?Rƀ 4RT ?pa+IAu#?9x? ?EvHLmEC.lZkf\EEUTDa- r?\z/3}߻gPTuSj?33?tpi@8>\~?}'d0HC߳C @޵K[Yg} uۡ={]uW?y; ZxZ ?+6Җz %^»?bS$k yjos {H]nJ?Y?K5,SGdh&єIQnLrTyGxh=1}q0ݽ'[xQ?5"/`^ V m5- Asb0X;?хc),"ftR:r|]_-.d}˖l??fVR!lpmZ3?uC˫C9x_]{??peؒYb̉G\r (fA*?u]o= i]0 LrSnl?? ?Wu!`:ѱad؞eΣ ҃K=tb:MQW yGxdHZ?,e-<9K/wFE]G~o T_ Fti?:]S۷oټiM???of[Ͷ?[~Y{^rA|H鉛.O_Dhd?@S$ǻX9Ti>y䷱οfzNaS$lOLOwBgNA$w?1c?Qκ̝$=R/kjBGsr[wuiX6O?r aT fR}`=<ւQQquOmh;?ݙq4ֲ}uA vP1rYnŀvu]3??P(?jɆZ?"eAL|p\0NTWlE5d *BX H\ <`m?$9H KwPKwoځ2JonH_Pt`(Ow 06 $Nepu Yunŵ,w`Tm?M<Lmlܠֿߣ\cN`cY?ϷdHZmMꑜx)4ӇqnX&?s9\@s7rbkF>?/?COنԔ,݌dՌpoC,z:?^hL7bwy$XEI\!vt!e?-7bCظĝJ+vzI?`]]]JN?bӑ%q?;d Ӈ2sG2$~X?t?bg[?jbaqBZK1'Tɪ5RKDZYUW|ctEgGvܠAt˫^Q? B8Km գwr~sa?R7?3gkmi ^/ߚEJ?+ǘ\XF s?YC%ow? /v'ivd*$u"6 kɰ͉Z+pЙaڻ-Hq uVEh=y;/z_If?g2Zh?I&)(.j ?UhN2'|(ve` {R>?iQҮVZ qJ?eByQ^l5Oެٓs' ^D?\j*D&.JƉwّ?ït@!Z;zQ>8Ƕ~RESvO_A JLr|g}?Fύp%Kp5̆t,P1?/jcY5JW?AbG>^oYղ{7iV䕃D*b?yi[C`Ec?_^Ί?J'SUbZތ2M={2o_M;OJM?BVH?IA?Ez ?\?7\kwSɪkEV?DQWAEsOq3}>f?:_%/VwUy{jz?{y!aU G5"ax? A]&exx :6ep?? ߃ ׎?pA [?t~h]w^Vj0ӞLA۳?cNr? ޤݱ3š7 ?Bm˩??g׻ѳY?\Lj-)RN2h#CD+_ŹQZs, bT].V?6CCyQ:TC9%3I.RյbeUPG _vwLi.!wR7jո0Iݛ`^ p?yӬs Fpo"? } @ М?"ֱ_ݺKk`×7]@h?m(>?DXSb- u??hYS]UpUH?oYUD4M?Vc{Ρ}0\0@z0GEtɵAZw<\72??\ @ѼЇg3wbaivE-kgFYbP⢀b= ћ\zQ?ezERL$fR79?\ȣG|}4?^CW툲uZ^eM4?g^4d{Cb.q5}1ѾG|T}-u? `d?&4%??ֶJ?ƒx?Z?1U!FSκJ_ ?RсVe?6=a.I1xT3NM-?Y?C+e ?'y/MgIR'Q~\"9ʱsrPQMk|PL9ʹk#Э g ?gjm9KMmE]v`o뮂\_,7ppg? ?ٱ@qu?lK?ƄS9-?Umu?[q?UlݶY[S2X? ؗez5'r֓Sqv7 DT? !MH8RЪM@ $IR?_kٝ{ BS:~?G^z}#KQ?%[Ϲo7g(VCރ{꾽6a1 TA t-,'b?OS?iC? Ǘ0?\?f [چWbwDO(m!r-ϦW$+ cMɧze&?[5WW슒?x?fU-WP +Z&.%80Mt?i+lfY Y?$B7%Mߊ4< eVq?pi?ZaK??/l>l&GYp=Һd#\EkUrl4PKH7lpALa܍zt?zaw|m;7nܸsο??T+ɛ"!#?/zo[n޸ܼ^W]?:>쟫{ر}ޫ<Ǒ_ýꉨ^Oǂ8l? q<LT4S1zM*zuI4EVM /X׷\Y?C 9a?Y?IO#$?l mV0U/_ ?bd r0I?1 \_[ V{?m>PX(?.+ga"0? >B@?6ͨ?Ҁ{oMش⣯~<63t "??ZLqSiDSVGil P`lӝ?\<:=UR?NvYݦr^2q3c6ϙFLsz?[iZ??m+ܚQXUsʉF8'ŬI[Kzk5S yemYy+fIJM#dՂ}5f=g͵e l.ds\>d ?<@3?R#I?8QwҺPcJl嬢師pz\捛mZyw_ 2VN~N~?7mݲuϟ??ၷz?[xc?SĒ8s+Z~iӦww?|GK X9D`w? ES"uVO8=aKmJ -DJUU! URT0@x/kssvٙ=N> |޼yofy!ϭ?Y;edO;%ep0I1l?6{ ?/ah^ 9q0$gӖLx6y8ztGZxa+jE $#m/;^ FA}U?u (zkZw[CKwu?zHA}OEirrh7+?ލ;6c!$젃v5} j6:`WЩVh?0d'C>\.Vno0j a?b ~ºỈ{2 Bh|a'F9ڎN$G.رpl>хs^̿N=ZuZߒkxAYRP!?ʸnDL3RfZ(Tv*jmRDd?atwok[;v]ٺLY \)ٓnʔh_5TSS +JaA6J?UI3?sy Q]P^R$H*T6xˋRr(zv}?N[{rx;':aeL_jz_ApL0Zfg??[M|[ox[ gM ?sפEWżš)y>)瓒̫IZqYǽx?˒ yMtE-{+] {4̋ d#G?#hm;K?Pp r0%x?hٓ[TKRKe$9\y|яITEj?k{cQx ;Pڅ@m|ut?^lÑ.Xd ~?(LMGG0&d tKt7E:(rN@VNVl=?d4^fBM][Xs`ob`?b?p'aP/P:FM@]QKw0D?? y@c"HOD?Ù^ G}޺b][u\ E?a?ȩQɕ) |ak|L\H<j?`Vcwިn5*j^ߩ5+neBYo\gJ&bVҖXVZcPVtBhiQOOh.LqnLt?y9˲??j C+Jj?ҲT?VU  Bw@?!!$$ @Bn?L&c{|?u.x&I}Httt||g}y؂eH?pKwN%{ ]+yg?ܴQF5;ٳDԆ9?w_FWr_%z ϣ鿯ǿFޏ{ө{ đ VȼVeJcօa??e?nyy{k?٬E8]RAh?t:TES-Ow\'d1EӢ^:D' 1$˾ldT?= Y XV IU]LzIډlOZo]R r S+o 1؍hbLfnq=7/!C㹮k(L17\΃U SUc)KRAv?ͼEpn?8x|r=u?!╤Ԋ.ʁ!^"b n% rC| Ώ?shvy2?f/~'?SlY] }맷.G=Yab?yCs,2Ȃg7?_~nlK2>ia%x+QڏG>H ?ז=ji,D(?ß7>BM3wWG?i; R ?]^a+N^-O07dz \F?zWoJp3~ eZq@?"zZwuhZ%˴?l`X Hw"чDnf7 k/.u$0Bt!}X^^bK!sBlJ yzQH?z!C=g ELpx w?&/?mxCc͵1?M#~ө_ H?X!5JIV v d?rT.}))!P .c{+ZDU}WSy!_x|hzө{ DViVbhF У$qZԕpkG zj3Ӂ`(?D󙘤S5tt]'eȦôa GӡnZ4씀mij VN` 'FrԻ۪l̀t7 HP3k'~7=v,CA?l+ݦ1 TOlِ'dJ2~&}-]O2D67kHD[s?Ȣr =ΓOLHZ7ٻ7?|6oڬJ7ʊ]/.Bu$GH` ?+R pfS?61n8fԝ^[m{?CW7oޛ=ivvF$顀8:X{xﯣ*rW?w{g jlhl{/p yfQƶw kz3{{w|USќwO|?goÍ{J9 ˌl|ܡJsEXce~M?G(¸R/B?]zXd??CwFЋ*AEe,$q7uNk|T`z?UPtAd3L7CoҊItAFYd 0 Ԍd}3mb1bQ3ɰS45&9bzi‰8с?8j6/[ %qyE6k5B2{aSH?.ˈʙv?:1?JQt?&fd?uW?5',-o'~m+?xG??MjѨo>GZ ?LD"gd$<x:Bb*HeL,MH"Jm4;zCY\ŅE d8$xj1R,Dh"HGɥT2JR2|O-))YH,ҙg_Xm l#9LDްO,?ZN'S ?P,# s?i1?WǼYB1W(f ?1JcEBMl|G krjny:~;i6^v:Ka%Q?WbEKѾ"scxHcV%d(84ɔƻGT a]VŠ`փ:?[(:TCAU~0[ ^40;I?I@KkJ8 ʬ 9z??jw㫀j>𖹙F\kQ BL%Lc|hN:~A ?|SUu\oڽ5e+G?AL ?+X?vQBpNM@sUj?DEbb4q*%?>?[Cq5? :}dd+X?jO? Pu`3v>bȔX'DaBz 1Qu,W~VC}T?R |-?cJ~?ku9LRȑk~p xtp{?ww ??xFȾu٫om?M?[\OvTL|3{~kVz㺏wn]vkYu{XڲìvV ?i:7" H9TmQ\[ixz2`?C??ٮ?qtqc]v[ٮS KW:D=pnFĉQ?V %Eh^Ê* y?@ :?Yw O*8q ge? ~X}a~?I iZ?Z5um/ƏB7-cTB!!IJ`B$$c|vlO_۽;ԯ:=uz>Ov Iǡ!<}p?T d SF*yF@ ?EfxdN F(R-4ܝY?]"1`1K l@xL?߇x?i}+d jOVۇcY nnjO?-v@ի$?LiֽͺWZlѵyֈZ5?40tLUtR?fc{؆Ns?}^Lgt]r+fnl96Ȧez9>'0j?[>w ʨV??ܦWb\6J%W6Bak[eXvPʓ=w{T?! S|?BSԂ$Hl-́ȹc ] =uͥ*QZ"?5V,,iVu`f].E?RQ?%]V ?@?EUhRP?^?YǞLD ==az NpfDgxGƺ2Dw@Bc2&?YRB/ ݧ÷Ͷ޷W&).nH+B9-"9z A: )?_Og4r%vncL4?!YiZT RbpCi:Һ?0wpa?NS?GT-Q? VkX/?r aM7)BŕIE۔c`gvTͨմKnbKZTbr?:g?wZ^HGo۲,,Œ?vqwci?sFf7Azí:M] kA#nɱ @qϰƴWxfӟ46`U }klϩuZ?a9[1M0/XeWMS #޻g޺W ~z\c? _"EppY$ IBNaBa?V?qyN{,6Ʋh1J1а2G向<4bKT4˓޺NC*fQd-jIʢʲr5U?ZV@*EVE50?"s̩^Sh ~F1BlW~ |-Q``ٶHx?DLJETurOHdxйݭ/{^?rӤVuuS25؄i3r?C:MI3e(IZZ')P%`?Y>$ֵҮާWeYe㿤O?(3};o}?92Ȳ?]ffc"?ЌiQ n-ZX o j +VR ?3F? Ӆ]o#Uj??,?IBe%IeL+B?P?pwr;?U e=?#ꋯ JQ^B:: V݊8$pJݘTVӐ輮O*OB[Y=I6RB-"QB ?~~x!Tw?{gWD;op դPUTz9yg)ymxeov?6??˝W-h3i?+pR`R?|_v[vW[?Ya[gII7.{ 8 _ɗ~gЌ?ƚ =x&?|jo"B W ppW?qPBQ/?#Y 8+ŘhBDp\{a㼽{g?5>?x@z5?2`XTZxE<"2?GMQRqIYZrPYLPNv6} NRI%A ?&G?[ lޅ$P? *!_eZ4?,hha"3͐A#e1v;x[ @ * /?M1˺?v˟??g6\@uPd0lkmNסQSՍl>LAgld- Ri1b[Fb#??nOgeTөLJJ崵Dzc5Mf63gق۟e3[̳\z+3kPlFMm?R 쓇V?s xHo:9Lozm=哹\" 9 1 |[۟D>Y_Od|*?p:\|f3-;PHsϪzL Y0F{Bg?j Ta_4Q{|]5αjʂcc _}upi#"أp޾:w Fa,"C;W櫑ޛ p%9z$A`?D>JhEDQ HeV?r㪡im6 YVIyt?nm@*29~M7*p?L?!UHU?s rT? %TDGuyO?ƪiHtkwHղ`BF$҄w`B0[xA*Y=EkX?zV&N\nŁQƄ^~PR^NcV?l8GV= RUH~Y l eD\xDKQBН*u%s@w@o&k$qULz|?rZ@bXDxKkK?g?>K>eJ?&DhdkܷwK>Sg: ?eE?q}ew}swuϋ_bK숉?v Nn\[OǗWYZ?P"h?f?[r[.M]`R֍?vq^:ph |ՏPD?ώӔv?\^yOMjZ` m᤬6p?'tR?3l=??>xp{yPЕ \ ~?-ތf?fű~ ş6?IU 9KTuc~K?mhUAM%mBjhPҔaiJh ǎY`l ?^glϾ}Θ?=C^+ѹռU?BB@  «<&?Q?ȈHR5S3,H∜s'ȸȆh܍R? 2OM}nNt7 MCs? q솠?F@%P_4:q1Ɋq2MLquM?ECH7i)%)i3dz?ZE4i}`RmT?fZ/A騀yKzb犖KfI?RM Hgm?6sFΪ[F!W/Zp[EPJNRJNrŪnLɼ5O?9Sr`m͂y ??z 2D N԰E@zzZT?MA?]̵i7?۩|r?8N٬V}[~xJM5)|{~s{v,u"C׎nS`M҈wvM+v?|#CBĔZp/BK?Dɐ?lJ?:ɚT#jiȠ0AҔ p4̘f(NUz%?̯sATϥi&`!߀  BL =t$nrf?e_٢VL\Ȧ%#(?Bq­ܟPJ@?h mQe1g٬?H`CZ?Xv?+*^ƃþX?]N r9EvBE3})qyQȦ?+˼࢈֕BCEҟF'7VO?ŔQ:3itCUDsW#EetaE.<>'fGK/ G,P? Ix_?^yaO8ڣ{WdVI+?v81=q'Y{powȵx9|>{"@8N q|@4dNQ!6+B?IH? 2'H?H),,(0?h Hɠ?d]L?)g ]2?auYe KV?-k"1pvaAx!ZNUUPO"?JlcJ.` Z?'z#&QjcfPl2MBCQt gW^2Dh^JOX?@R1~F@?L즹Q!5)?MF* "$q]~FO+5;ig./  U@  с犿,g N?7W^8_8ګXITύf?+>RQ| Ê?ak(ZN?TT?`k`Z Ga`dar)`tr@RT3Bx0WXMu x?K I\G͞L:F?@?Lc5ivaBMfPx# C Z?D?r`oײ )kC˾Xο\{rF6^6op_/?\o׿K_xڳ?1?֦2:)y)DƂh袗i!?~OGYxN?~ .| ȲM?eżo[Q{tCX!Gx~]Z ME.-P-lYqP,FE>5c\`x7l?yK0 FΉH?q?kf?]9? Sqiύ>bTZh+b)hNA˚il}i:#X^{8qq}g"?2I^JpE'z(li??d,Ԇ!]$G~a96}_ kx٫?ƥK $|ªtN 5U^mIA?wa[x?_cZB{}_'!d6?ۓ}h;۲n$y0!4r"?ߤ{3cUGM\?E?IVDCJ?1(L`3@;CA .E ix9?O"ove<;j$Yh?}Qasԣ?47xnrfnzٓOg>~tvbffrtII{罗W .oّpD@GE2.F]ke@P ^ͲqUƭ?]vJoZ?@?xSXijmX[e6x`tS!Ӑ2 PTUEET'EU0L?$]c )\N]9Ҷ`ca qU\WyR-?5 cmfzkFiږeP?m?| "ԙ<ǫSx Cu J`?Ri]W }!u?d:1Jl?fgSm+Lds?Z0?+ dgoΎW"s< ?NS? t FH#zD_,FD~s?^|iz]V(_Ͳ)p٪快x?ŮQVqYy\?|Œ5pӭsI6M?7]tekHΥ?>oE_xkF igix^_`% ?uv@=P덅?}? I>˗i?aZ_Z?T>me~? UtIrNj|>?.~-qPFtHaEf ?Yj'viW#\yD #V.-_?@G I xH ?湇8Ƽxk=2oI?+aF  QUID`v*m;X*ٰ-۱͢eZ.wl\F>$0q^Htg# ;ȸjhi N](G7&\ RU0BIkN ӤVtAHcIաaɭdCRDV?gH%'ki )e&H+ijPz乴wT6MGህSP=B:谢e͕{?|> -TA]O߀?@kRr#7 kFayya- \+拫?cdLZY~_dKY*$ uO+󙫼1?>EL<,B22/\;}t?wT6$P:^U Yn&k"?W?ENCwNN@oNZ;QLU Bv QL?M@?^tbE8ELʊ.IIM&]sJ Q,Ai)2"fh?D H?&=ꃔ9(r?[zҒoz,V?q?V?D?Rc/`AIgX?BJ Ӹ D6hF"cLg$шoٌF]CU?7~zH#n_P2F1x?pAȬO S} 22_!\R٢]IDͮpiuQcGyiל斵YYԫƐILp6kϓ*h྆ޝPiNZ??{4?RhiA PK*?:Drdu6dn/F-x'4@]B*?Ԟ[~bϴ/͝Gʒ?>OD"?r~:1W$FnD/ݴi^_?>f}?ݵ ??['KJgڿ .`8 ~&bj?@Ugo5d8鬬NZ?՘AV?"ot=:wU'qGڡP? z!cc3dic? >H$?Q2g /q`*,DK?)*ϫ !kIc08]1 . 0q$!%?G??$&и$ɺAx?Ԥ⼓dWbuI6 Rt]ՒRu\U01& h%ǣ1p yZ ,&B)KPW6cdJ=Ӻ{K۷{݃l㓱`IϩÇ_n;5o>5c ,ࡿ/o×vcv^ 4A+pE>!RBu(2OI\mt;"p/닏vQQD]Q  LUSI'٪,+jHF^`-DAAƛ֌r?nG(р Hއ_ZM[SG.&It˦(.eEETT_ ?RKeEŁ_Mwg?4?!$&NI!СOS`b7kmc|c[X?ˑ?ɒzvd˒ I˾h?eg}yf~yE?RNIaL?Aqhga?jQHa#q?x wcgu=ΞtkcMT-?ckyj?JNS?Xbn$8ܝdom`_@?1?da?{.$]=4PE2N?9$FեuS{+B]p,Nޫ ?˺Q7p=X⽕?_uҦݶK[g*jꂂakn:ڱK|?S|ucwV *m_f.auGzcZ`h?l8[ ??{?Fˑߘ.rK6PK?Ź[l#sGwV"Z}r1ovgkz* Qhj?5K :Kԑ?JRykkZ-Mc>C(4fФ4G$UDe? Q;oEQYg(!j?? " Y?"H?RTFUU)?C üe[ AC* P=? t?#=/mVT>dIɯe5(h}h@R"QP?݂xHx8BF6 ?mDiُhn4QCVg?Os٧3dlY:]?rgL懅\V_ R>SQIG~{h1Kgz?_i&?])%&x7R?g뿰Y?EUQ)"Z& :n}~pV㎍{|_J9 Xq/JZ;?sMVzGExPbC?u?3Ìs ̆$Q?YӁiO{=<ḾJ:?,ʙFLOn_T~o^ݛ;>T?MNDNj̐R}3r:MC!q+I\KB?nMcB/Lp=*t5`.xjΪOS=~?ؒv??q.|z?Lu?}?|PMTB p˴MdB$_aZ. 37u<t?${QXq meBtbj)y n[okإ].W3߲KV,]qͶ~te˖YibVd<`N\ j[Om\W|?P7%;K%?Y}8W?O^%E[5v6}x 2q}/"P%:# 8?^PD->%Pc\~@?yM?mӇcv|xA4j qJ?!L*?(\FMJRDGY(7d%KKEU6Gp)"h&,?c%"Wɬ?U*?(jr~oGr_ST?6M3i'GL?[fLS`QQX嵗{ I?fwܟ9~?G @N+ glA[YóX `& Fvdde%N!HDPd%;Gum,xѩ Huo?j?;c/?@] R0)et6xzͼyLxʾVtO4?ӕUjziY]\?:nsZ({s݅Hr?a~?>4NM,[;;û9n??]z٦撿jO#i>?vZHm)ԟ!K|Jy?~h=tݦm˸Tt'rJHr_<ɀ|az g@,V[|_V}HM/:u/Adi?}}R+{[;ON؁N夿rC%:]9?7e=u916NYVE:oEW{>??P_Q ?@??Zc2?"k@5e?@h#O1 J*J8h:tF??5?|t?"?jX:Cl|R׆RGJS#m ;g(MS62z5 zq.Rxזw?iͶsl^ZWZz/pp`VxTmѐG]RKr2 U?! S3d$D",N]h +O \ N>3Vԅ%! ? ?c]ͥ\fT\gBZVzދɍr7= 𚰯\k ?XA{H'R:|}R fJԨt)bl= vG˪G{y_?fT'L[?svLan\HEm?gkc?w?[-r?:b m?,H`i5}6`X7G?4ĴƻO?L?=rr?Rs ҎN(?;'?tPCͬZ4a0\??`JI.pRLd"H3<3F?UWY^5*Ka ??S>.H:Ye*?Ru^(zSb-S W~- g??uCK[@[F??@ZgI7 +JAp?쎂i_z;>__^86T#IW¸XLt?gz/?[杶h?Pvqq.@4ꐪZzyzRf5?O> m%m%?g⫞o}dsÃx~F?bvW]ߵo|| gz?lm aae^D!}LtJcMb?6b&%d? OE|c:K?eB^[tj?!9#ic*S=S^Iex6mS:ᓻ{kxtҟ??Sf)<_ ?k:ڱa|WeS-u 2 nVOtħ;{G+sm?Ol7TxU"?g@lHI?:FYi)CQ?FvxG`?BlpQud`ݔhaޞ?iӴ?$Ba CԤ@ m va|ǀ,|mY?[–j/?9ؤite&ه=gg$?㲣k?ƙvdJ KlVJ??H0u/G6o2hszr~O?|/+F}T0?s^S/IcD݋??yycF4#1[i?M)F@\ƾŗil?)㦆sGd`?|-iۦ_~r+VQsLaVp+#W򵇡譣[sc?ʡ[]rKt?6|5㫁} 44~Ub<} TdDXGc =?C&<?c?>F䥦/rh2|>;yxeNu^0U!?_/?|POuR?Th={6;I߅?]!n@ y/Ija*Iia 7!ћ?L>Q? @? lǞ.u]dXb$?PGۼuBu΃mHK(2kF T1.B2s4><Щoҹ m|a?x hVXrK4>Ŋ˔XKqjZ͢i؆? EMw\2 ]c۬TI?%}C1JAuuyiM?ɪ͂m ͡Ui sUW_uá?~{c?`Y?L?bL\X먈)4x1ӄ$-~adeAeQ~Z489D] 2Z~t3YS> tw??&gKn`]?kؽvώ??v{,];wdH?eMRgW#ohQY5F0~"S@cV ̖ܼ+zs2=&F*ߊ?X+6֏\مOzTai7yvJGgBWUw=}Bjhc` ??? ` kPEkOOc>Dڋo<0[۾wkV]"h?@4ed3@&Q'?] UQHN|p>A 5YICbβ-}oJbc.Ƚ|iDCP-K5m7eD#чD%Y_#Uhn;سf&qY?Px+c廅ԷTDjMf6#OPl^Zl-?B?Mt|son?vԬ?nav?%u^ k@Mղi]b_Rدߨ3?}V ?ZHZQ41G6` p <`:xaݞųٳ޹s}cAm^!oOGs~_lcxj@HcYD P"K۶PmW 5<÷N]UjݐtL+u(n?S܉h;ZؽsoYY6EYV4S!X )? ?'6B1 N.0yVD@AFEEaϰrRL~_z =lY ?E!p?Vd? ??l։C?BC !'d !뼶_Քy]YoDZ\Q rffXƶF )F\?7-->kFQ5։^l k/-+Y1DkdUMLΜ;?#,Z?xpxkOwql{x Ͳ?٪=ǚ+OH1,QEI(?݂4[jnE^?}7?D;HnƄTZNeGOCtُܞKl\s"zx:h٭߷ٷno[tWqb~,OZn?hJ$+ jj?[aVMSM< d T;9YF.&M19<?Cbmwo:ooMXI-?%e`RFx#) J_tYxp1"ȥK{9`?}?<{?l q?sO,t#&iU:IQ_`d'q:qFF`ŭmӞCX}y}Rl6z_T q5d WӼ ,⁦t?˷af?C$5̲?qܬ?``^Kk/ϑKq^}Žx-Z`i?ӺW*Z?E㹤XT?בr8DF`-?MJ8`s}$YS4 `5hԽzHK,3c6!:9s{?QbKkz޷_H`K?=`yn'?0YduQ)X )5N:jA<m:ămXOe^wy[DžvLo?!+&c#[#YM3x]Ys֧RD/;?ֿ>ݗN$dJ?"05UU?Qy? ".rf4lҜ 0?EtAą#PΎ1`C8d?(ązӭ9hMuA8w7kI ''4 ]ЗYԍRἊ -(֐WżVu6nXZEY/ ?uӴ\]4{+L0W5k1W,\8QMdXPJsM֜{ө ҷgsg?&O&̶͑'{? _Pc3؅Xb&GxHGu1qUn35>H c;K{K֫?L՝ml_`VW̤t?pO+?^r[ڏoig}bsW}L'IHɄBgsG܇8|ȱ-[dˑ%Y?]I{i!Y`HJ72yfgv~?O:-ZBՑc\zA)`?k3?_Кy̏މ?q2]u_s:ˊQ׌DDžmISᎡ-xDJUfc?_W}":o+YDe,cQavӂB?;=ӛ}ڒ8篟bImA$S%y?H@W\?tDUzU[.z|.jdNҀ:G\bH` ?Xb$?}L`K?PtUdNy+ dUUtԒd7'p?ׅoN ?KbTOzmqvޙ~$?>bN??&PLѡŔT?##},b QSsl=N>mLv?|f?8b@lsR Q|$WJ0@]?FD;WJ*/QPZ‹yɘ`qJapzrDG&ؐ\t?g㜵jL܇ N _0zm𲬼.zel?Wo_^QFY^-_o޼ô EI+)z ?C]LM7N٪;|6|?^C]uYma? Ϫ20d^ Y?d?$i,?U a Ï|B݌nmWQ ?Jv?ol=Bh$7O_?@Ku ^TM?U(DZ#|l/6>f^LXnE I߄oZ>VmGci+?'$/pՂ\PP!6DKZb׾?.s0ͩV01i?eY gD!H9>ȉ A1DRNlBm1BpC $2gDZDw&3ɎfHr8ufh|sQ"FdTlLQhZb8]V S:rq)2yx,>} .-?b?oKĤuj[__'?]'\GDĕΚ j$$Z N[OO.-t#U/5\ZʙA"dTZ?5;IQQ >|E2 YȰ 2dQcq1?\:|hd 7W.\;4WwK}8!Ъ KE,&QԚah?j#(U1|? ?)bl@T͐?)SDSQ kSPwq;vޙ{a&|c]nLrY-`b6?Eĕ@mxaUDq?bѼe[𥘤hYN5S?FRPbbM??~Gqq䤊rʉbaMƒ B c2F:ЉEI^iuZεs^]Id-E=LKTt~u?e!˚tG\یK-rKJ6`$Եe Ч>BX)pr'LKj-$?.OãA3I(AZ䐚B*i?#ϥ3D2Y1n^mlfrf*\No$s]R?3^f7__Z?Yd%e#W?pCT/7Ϋ?lY,B h@?S!exhd?E*!nAomx#<#6<:'{o?hQxJ?ǻ+Cw] 75ݾA@aĵAQywm 8`_/TcEsC [?bk\Bk_J"乇BlZH,}©PF?~Ї=cޢvSY.<4[oĦ 3KeF+GWFxj5va >+.?WYŏVھ/\pqWg~X_?DOq?fLFfdNJlg{CMom޹?kg?;?"́CC^C Ѵݍce(qo?JnEGѲ(oQ4t?äg?} }0ڡ?_gMdW?A I !d؇- ?C f0` C1?ƛMjY?ZzofQ"!oST[ýO?6 $ 0E;£apL?TYuERل;y B?M!7EET(qChąVucC`>(?*ڗh}H[틓DGeD\M?-(zҺ9ͤ@Qav/?ZP?CuQe==19~3)YZ7zhߑ?uU\vi_?f29cygugeo%1;X?- K+eJ Q?&9VjY1cj?>ˋSnk,8eK :5ggoz;ЋMmuC]i"iA7e?lIbxw4}{`Ybz8D{S?NF{  84O[? `pBx.'"/Ϋ`[>HJ?AӌQSzlNs?&?'^ua4?EA4.J2zu6Җ ۮE\EH?i͇jυ x@SqW0w hOTF{עd}ub? Q.hwհɲ?~Ç1M`JʅvCh0ED)ƅ3?;cPm[>r8FU ʨ,j笸-xP'Nchh#dMu7 (U%N X ah?#,=щw| νOLw#=Q;6 Ff)b69IƒP;詋{*?`g?  x %⢜dC?5D|P. IUdM3TtCUٙq|?9YZ{9vu<>;Tpx{2F ĀLX̐Oc"2?25xD ?sUZ?VEUMX]$Lƥ,鞊1C ({bQFhX?/_woKTw'W޾Jϕ~U9_.{y?!Ko/?J.'k?Cw3V8NuG,>[ϧP<Ͽ@?!2FQHht?JXTkBo?]2yLWx=68IK>;:XQ(H` ^ӝi?wAa02sZ|]H$Lg%Uţ`?ف ]omr#YzK ?_+ eRJ~t0w4?ec!I?)dY@?-צuMג|NTTS*DB9҃~KpL&!pB5-d`f tf1d po64L&?m.2)T-A'6@k xጴ6ficI>B]v;k? DZۚBևq8"]bK޹" )fA"^$?&??alˎGޮz[r?LCtF\MNS fhLQW0[f?b$P3h?jx894]IU_v@csm?ߪ]cg?S;aDsܽ?8FQ$s;xl^F}ʙ8$ɢ!+:EiOE?2?vMwCJVq?׹cΚJ?֩R{eumFǖpi7\zdB IF $?d9Iξ/9kNv@?=~? ?bm^@[P?uQolJu]xWg+9JXJ+Һnk%_r9%rE1WPr??ϰSݸ}HL?n?{BA~ }vmls¡!bPM HBdEa*A:GA|N!?n*#d^wJL|=&CWJg9?^ÍskmA-?f?߬vD,~J eX?b  LZ?2?)C䔛Ibu>Xk:؝O?@b!hډ >BbRb 9eQ܆bf1<9A?<o{z7B1'/BD("At8/?EA,AD:SK/>;N kd|zə %?A?IḶ= yvryyt%TsThvQ,`z)W??`'5< ^64?uC])C??ۍ};ز~4?M#8ȖS *fiB?§bKGvYl$qL[ .Lb÷'wM?xjD.o PQFA'G.=譣?]m_/!gs(0p9ֺH? ؈IWx꒠lB+ ? lb?GMq(?hY%[bQʌs<f3n>طuキ?uZ7?#ښVԙR?!Ur?ٟ&{v1vaF0fc:A -t&qiLxZ??QT{Cs&Vfuu U(F|HSR4obZd?? 8$mUS2[^  v#'2e$[NŤ\|B.zm??#?^Zc R?֤F*Z}Ubvijj]ʵF-Wꮮju=o?7XMfeu`V?H,S\?L]fa?۰?\? f F =vyfh= "xV@4D{ ]B?@4O߂ՁNOH߼P_[('*Vyhd m ,?? "ֆ뇔؅_-?:?К^v0XmB?rzQaVd< T[?]w~`/E3 erU)K˱.???ºIIajA?keˍǗGo[>4֞Y ?}G%=?]*Rm#.? ?iυ4B?QiXϦb(ٴb8rᐤbx?t^??9*ՖK&{ƈۈdf 3 ý3;ƍw(?Q dߌTi=?ZEsh6@K]PO? PSȂ[b򃒚U?Wˤ=uac$';#~_>Tup j?zHW>wu_@DZTtj?Mm=9lrI??Ϊ]4|/}|EsF%~ﯚ;NUgMfgDM?^NBmӀc0AEc\IOUYoPkW/|;b%`qYiC:r(gtW6cw?G#?UYϪ{q+XꐥI Ӣ?!C\HXIWnOSQFJxMpI8!)$E]ac7dykb[?ƟY?V}e?&"TJ<Na!*{TjQ``|:~ۅ?98nl8?|$ J<> _pj?CpE֞]?O? A=02Ӌkoec?'c?oʺci<ոI98&f,nOPOe|4ϹtO?cr?,KhDd |ȥL& ^rgWcw?H1PjGo=ǗR˕J,K;v>^e!Uri=2>_Tg\F`Y&?>Jݓb]WQm'Zn9 #M?#r?hC>SB ?A?jH׭tv HHňI HDsgFEFW՞JO@3Foޫ?H&(AIq0 Balધ󬣣rK?ĂTLAsom?H3 dAgOn6jn0 rmD>|?Kd \wj~:}uF*bRFi*cG~@5_lS؀hT3l$b̋Rܤ(?M86?AUb M֟ku/댆Pԛª+sw,Hy`۫GkBw.yoc2A]6uܢ?2AG3 *F?-T@ʹxh Z|\vaauGvѴd#83LL&3Ϣ! Qqwɱp !prMޟ_?I #p?mqj.]h$EΣ Fdg Y/DV `ngI]UC/ T|?|j?F,'[Fs?sGX?~ Z^(WjS$ǃr?qL+RJDDD?RZTJEP/4YӒŸrLVd[o]yYЩ UV#ah?٨|b?0P"? ~kmq}sd 0w' z0eOWYƚ?~?~[M{GgG=' hgj?nL@u\I{{N;ۆ\v.#)?gjڷdMͼ_Y'ᤇ:'umo5 n}gهka`IH?BǵP|1>pکTJ? ؈ WVyQMAe?N;q?~}ɳΐG}?(0'?"Y$W-[RqqB>)\qT?s1ˏh g]1T? ofqXmJ.tϻ/Hm?z?ECg8L{?c?Ru~艓>aC&*rBƥT /?%$H?ut~q`Ind DT@ŝluV/g9#gxJu=ӵLN Rt#Cvfk?c?ḑNb(SyK. .v;zå3?'$3]x;L?bWM'R j?b)ϗ?^HO?_ihKO - \;?’c|!&ۡ'M}֯?}^w䞙;5˩u2h{7wӹޟzXASw?>V|-YՕ)sJP u fcrfᜲ6xcMW{Gs L r䋿Fkw \?rhVނTi}si qKp-oO 1a3r7` ]?\ X?dʶ4aO]4B^w~jT$:YቖRO׬=:^D;zIyIC DK{,-?F1kd[Cv铥ףvtBs9Pv?'- -swCa#UE@?s?P[A*Ȕ\]",E?EXo{ɇ KٿW鹽5Ӂ0nB#ɗ\QĤ` hľ (x?<QXcplg)fK>;OZNG(ĕьR0lO?wB ?Y"[`t5.A% +χQ?Yr9XעzO̶?+ds:!E5 ՊbX5߮Pmm?"W*bxe+Ra;S,KҶ^Kg?S?IPQ 4?ʎ^ܮV W?W|{i=04$iY1?iɊjVVuݸVapׄ(iGc*=d`"P@4hc#~fxQhDC2?3?qA]O౓?NG?ETNǤFkf$oll@k?LQ]VzIA?LK'9]fbfFLGn+i5KL*{T -gæno?+Z )lL~8?Bsb? X)x,>ĻFTl"\u5iк@ĨRL@sx:T2G[x??^ɧ fS?rb2S`rO? bv]mHK B Dv"~i >?"[ ]HdO?ZR–n9ͪ2ƽ"pގj;c/Ȕvz[nGMk^K> ?dN'M}?ݯ?NK8ꘇ~iC0L&Vvg?Hm굨%d)%7R }x? ?›{jߕ=#+cT 3 Q^O>h{]0h^H)g(gX?^%x??% \JM8[KdQ??|s` . p\!?Rd??Rq/53}Gz- d#fx*jaqt2n&cGu|j!< @|oNxH4sZqD~??l4E?(tjɈ?a1(S?I YpKSQ.ᐵH0 LAH;f[h?/oiDj:?$Q hDGӬ??jJR׍o?%%Z/;NjTΑJ AwoOFF痀Ǎ>?(fJ\Xvx?tPɀrN !~ɬo)E!BsI2!#5Fuuĵͻf[Yp Y&noW=Zcs?|~C-A5;u5?l3>lYa쥽&f?}nw]s NE^dJOʰYVTTL,2$E} L_7Ҝ0}e_B?s㔳r̡̓~6xdK_4W b?l})Ѻ ≒OQc%hJvwss/n EAήb6zA?G^?m Ϡ|G[Jo~7q?[NIe-(IXH@ ``` ے?K?[Oޢﻶ'ɢ'ySܦ{S]O_݌S =?iKuv(2 C^KI!<ŽRw4Ճ. P7>mKw]Zl=<?M-_z4F?_.cF?|{?yqQD%JeA R4dҍRK%xUYU UΪ(rJu"7~s`lS?G8Qi%eޕAXNrC?E4(qEU`f\KIjeLiHZJR8r+G e T11>٨ؐJJ?U޴VCc,|?i3f]/׬ l`d`rAI?kk]wFЫ?JC? wj]*nh kj?Ub̊ ΋mbպbXq4 F~uW-St?fY6M?fA嫨l?X< u 2 NS.z~UrNTdGžS;D :z`Yעdggy2(w_NؕmhOK]~s/g:?f?3 Q)"oEOٴģjd|d.NCA$⁑,۞phɭlHN\FP Za"?8| F8r]B?"4f?8<לMeɊdZ&ṢQA`tUU:-8&??EC\nIyHE,@L LC??i ?ݙ}@~A<0@ 9O?9iYOQ M%%")K^wދZTYQl=W98wL\wgc_f $]xE0|#L~up8V5 D?[ƮvGv-oܷ㉀?}|^ysԬk]h(aV?a= {BR+?w[:xvfӊKV$cħO4O~u|`˖ah:ԣ;qh}+z29J!)?jzSBN{,{nH8,Oxmsk烖@hrZSmv亝qH| ըz96{ xyqL=BHM}w,غ[娌JՅ s@M+ {vLD?}+hv? 'vo??Gy] vA"JS:"!yPљ ,Y ?c???$QWW?"&G@?4v!>ɳ~s`̮cB/l_yį'u? bf?l}$3?1y*,rQL*??c?H-Arcl_Ft?+aSVʔY -!?^0 H?'gCt?VjrL?k:s?kJTl iǺvI,II?U?_uP3Ef aVr`VZh7jMT?ܹTHљƮ?d[,We(fQ5د&?CJN $L mpmiQs2OY?ےmlyjO?a_?? Qfݙggg}?OdK?ܢW0 3{G|LBAa?{{pv0b=`j}۟ cPH }0?H\5n-yР xg3 S'g?$2#ű6jl),aZ6_0@M??|Qdă/]Oj? 7e@R8gMV\>z^RYMKDD1MB5_/N?١5Ҹʦ\Z΋4F%.?#YjALO/ VDZWYk0?@-$O+$6#@UΪ?\Nw\[n EedxBd CM'?ikhE P s>i D q\Ԥ?ں`J3fK2b#f<GF)gν?ơzk :1k zo}:? Лjw88:' ?"I?q붌L?? T+Gf&HJiui^8w_wm|}M04ɤAA?1 n#zlt2G?%ًw?*Jˋ~6὎t\FSB]Bm ?O;7 t$ndz ?܈)Y o˼l?UYT6&Ra (?8Ӵdl!`?w?eL^_;k;:\ I?J?ixB!eQ=M0JNGEp\m,g?oUDTQVZjߘiW֊rE/{lad)! +?aVWRE*WKr?+r,i4Pd ꚽ"x—ו労lIn M-U?Ӹ^}e?/+$̻ +r{]ɮVJEZP۟W>`Z;RQ/-kEGeK] %dɞn1 KvvY'I&+C?w~r~g^<{Є ?yc? 0>N"`;&~#Ӻbr` ^j3Eu7zӟ%\`B"@i?r\2B[tFdg$6*pѨGV֜4Z~d3 ]H IʾSM?ޖwXlΛ{|JkŪ⩽`?|MIhpˇ.xi {*̉X2ָOI?Kd7OXw1?|Ւp&_s\ rW?:}?/;=`2 o?mngW\7|~֢!ab$R %X\?L/ ֩WB?c?nb#}??+m+C7lCi^30+i}|?Q+֠??CTi-sex?^{꯲?Q?qg?WoNh}e WVW?TfaL;*t g:e_~]bHxa?1 (ϒ2 l%K0?9XAbl\8' *DHKfw祣?DOWZCG } mK| bHhek#y %@!ah3m?HܢYZ߄IKV.lf)?I{[n6%%2+c8H? bN\ڎoy<1iI.<ɐNc-IxvI Aqe ܶy<L/Mn?%MVQ3)KYJK~I?91Ɋ"+&؄?b ^.1p `?>.< ?^B^6Tnuh~ׄ'o_xڮzRw?-] ?`0p}xIc{d?~ V{7*yo;G>y)kj]?F\ʁxcȨ [LJ<[QV̲\pŲuf~6J5ٖKT?oJ?U TJѬT%iEʫ],JBZ58Z6 bD+R%͂^2mVXCNsrc=BXHʘrFE|`kb LR4eZ|Q[U n@ЪYd-Z?kUmKR?:UH]!1?tA/bQTD_Ёv8ٍF_]?=B3dEs egn-Idb&??y)3֊2FzUE@H۟THYe'Bk%[b#W2&@|mJF Y:;/э|?脽V6Lii??MlcaGhNQ\ৃCOXx?,Dx$?ݤQbRte@C<Hf%|Kxy%H bb ??>l*8]d?Ŧ@yڃ|>bQH=x˃| w!^'J .?B1H MvsTF"?M@ y9G3(s?bG2Wyl,ƠeN<DFA"d?dED*/IF8e[¦K}ۭ_MǛ-!u:,^A4jERj1M2w?%?wmqC}Xޮ17?4 **͆?Dvս?^k7nid\/?0޸wz_UdQfvUxk?ilh?=|~f~>잿@?]ϭIz~;aq?T?LMf].nSxo?~_Q~7C?O|vẝcM{Ƈܼ0{_[Ħ}G;Z ]$ȴh5▟d^CInC* Ay:'rw}QAC\.%u4֭=n N^ܺ':ﺓ c^9<{?tJYF7!DY?S_?sj Ųq\n%?xZzя==wt#Y?K7Z"XL:C KqD\??~&\? yٶp{8AK ".pv YU(Sg?i}xσ *h%?a X_rHmGzV,LQʩ,ΨFE6ʂYZM/UtbUݴ%ڴ6_??]c^VT, +LT8:) E $L?Z*ď>ɒ9MTKoJ?VhkTxC!Rj~B?B~!23?2J??5TLs^`VP_܎FҲ!M$G0FX]נ\?Ui&mZw}@-"iUZQPlfkk}BFmSv -1E{[p{n wRGչi@YH bnGK*uy?T|IbR ?b (BH%(Z?H!!!h͢٧}? v>J{W҇z?{I mwݐ?J:ϧBSȆL۴{^ ?{%H2dk|3#ɀ yϺh[3C t{F? 'uQ1z5Y!`y?unT>?]mA$RP;Z>pmbhnO ]&1󷢓 qLaiǤ%:.!>?Ca5Qq ?᠛C̤J[&t7?MPtksC},]f317wd6ҵpfH\JA)bm pTJR ts@lZ6Le?|?Vf{CDx8?L%euEHHM5I?&/EU5ҐDòs/ߢ ;qg ~G?֧B?s?_~*\U˙VjʞӠt C'=ßtP?n=h??z?b ɃWAv[塓L__?|)W~v/ݰqܩ}?0q+tINL'‡Gh_~?7?͞_95 ҭ u:@ {X}?3yĭ_n0fz_QsT.$=Q?֛?nyW rD&?FR属Υ꽷}tnnc[_D:iHFL`gS@imG6^ҸG?7WӧKxGNrRsQ[_?Bmed~֒5ueI:I?r %dilP,2qY ҙw@w?lCc[4e.: d-ހ,]هmrlοD~d?=z!ٲ?8vk?9>3hM=OdGtoI/`Fa?_BGô!?Ca9bCVLKW ALB26ь b>.YIxɵDE|?D?`eX`!hNx T9a !AE?*~qG%?K"?;??eOYך?ho ,݂_ks(qMh|Mk?@E?aNxX7\~~~Z?Q G ?D\o¦F4fL4 Dtؒ ?=zq1$TQǨk& yX˔NF<T8V4ɈH|BFsӐ+،@xyZs.?cJ9^ϺT(A/fl2hR&޴i4#$aL$  TOmW{?R%uTnb됲r>a`tRgql䉲?lH9*kV?].T?5V,}m Kʆ?S^=M(w:8@,h:OikiHIs?:ɑ"!eL׳S~Tv90iSq#s]? %ZU^bx -L!?buˍ{9ZTLlWlpiv+&4??nrnv&BBuVyWF"azlv_#"bW+V{?>UtDr?nrByM|4Q?z0MòjyD/?yu];ܫZjJs߹ؘsN!sK?#r2o?? ZxVԬxŀDcj@ QF.v`d{gg{zgЯ??VSoUST?e`O%QJgXwoM}y?6#nI/P![ZA`#s*G!$HBC7)'?-&8?oBQٗ~׭_ ֗NT(NӀ"z1 BV?>+̓wQPmu7Eʠ >:Bvſ {~qߤadG ~~?Xyz?kt]_?!?Wy⯣_? ׹eDi|х}2Ow?<S Ggp/v =8yyLW/H: 2?.F?ƝXW3sN~Ǯ?vk?0ɣ3?u?kIKы{ǎl21/E-1+Kw~׭{ #ekƸX?OAsZAHt2Hok?VqdQΘTń?_\6%mC?@ d[︱K|WhަaTHENL?^_woˎkN ~98ֶi HDu>OHF_?4xBGuh>0 ?ܴ#?E~bgYht̜rGH!J I_B?q{ ?H ˋ#] g/´JG??L?g5"?zZUhYԢe6FZJ#?bi4͡&/Ȇ7y}[|VII O \??dKl* Z!;9 M 7O@jQ~ommRԈE?HRPK|~˗x\IԕĕjoV 狥LHwcZN,Oزq.Ɋ$k`hd^ ?<q<@?1a ksTKydpyEMy\hj?m b#0[{)r:s-x>fs?>u jyT?6syq7>}v=N1Wl ߰l{?H:!__My??SuhSX,.Ve\UQZd7 ??v{orsoHen{~/|3N|\j>l9zŖk?Q?/U잹rdنf(qvEeIҒXY?g19Ć4h_w?>!7%QņQ̳l\"og4Ն}qdwA1;q~0? ?$@` .e?1VlCNډZM%b N_!+J<"䊝^<ȑG 6o+i*PՊ@eRd:E\\f?$eNJ+?%(R fyqD(Q_FӼѓqivZN Z锍fSFk1=GmiY/s9oABL+#7kF?MtkOezO~gZ۔sh{m/z%U{,H1vR8|:|dnC;A HiT[TV?cKGo\dzTN;Rm9]2Pk7SX'zXe{YaNP%f$*OَMHQ?艹guT&dKKjqr?Y$c3l}uA Zs?r?'-U 6_U >K(wW*KGIDgNHdũl_vӲS?FoEb^BLs+Nz4a^=lm ?x}#4%L-в|?<#kCjDаp\o\9١D?\b~jz=KDKovUX4K|Ą“H)L\?IZ?I6&p,?UUU|y}oM Z??X.ēaP0JD̳jA Zeg ˃rAfȴC.E,he?ii&3?E@rnSH]Ӕ??Qnpƫ4$%􆸖sΡP+Lf$4+9!olXlVB?OѺDj,ԍ1k\q+ntt&3VvsK/?czT֋JsQ.S 9a='?z_S?9m)τT??_A7]cZwvwnpZ?EϤu]꒮IZ?og2rF?Y9'?{>Ioms/"rvaѧ߃?(ʏ?X3ve?#?ixq1Y a꿂nsw vOӓb[Pt߂n?>:vf yuՇb 1L+.n:Zb|o?tZ 4}m?>9?U}ѥP?}ģ&nX?Z)y嶽S^ ?8 @1eϕaG+r4`A,BمA$SEa\ y`d??ꁕQ ZY /W!Db&pHґ? ?CldFݤg Ce нpUDbuB>yELY G"N]ET4PyJi ?.&Ee LI xKЂ@ ^4BVYӫ۩Լ2y>rbP7]/GE{d?iYScAҡ 柏?} L зgw:kn?y?$T) Na f5x ^eY?khmtK}jZX??0oUש[VsgƁ&].\[* mGt ^ɽ#S:u'ݐ6zyz}[wӿu¾DBm{ln^i?U:cF ?f[7ܱS3GZE`93.u3:;D:!Yqrm?0f5auq̈́%:9 vOoöD*]^C?a1䢗?cYK0NztCs=]l:FgAblB?*? |Ypەyg`IkkUjh Wgo{5C0sm rdWJq;Ẍ$ X&Ő))B -?~Oݷ?*kF 1N~:Ǧ rKR?%9WrE)'siX@&sXJR",v40;x^D6V")@ϒ鈜 'y\Cl8ȂOP1E+y!_NmH[*PrWT?rV\3TơM~?WJMju?B?0Ql}P|VZo?﷊oZo2w|]6\|xI? ?3:MN V>yΘf~Y)QE-rRVQdEdEG`wӉUrSudi?GՃ% M?[0dutMAGy'DF!WKZ?A? Vy=m\SxLE5O<]}UW=h8wu?P^ ? ^tϞ]GZL?B?uTKxS?N5?qC ,BUp8ا?r4e?IC `&mdw Y( av]Hnj?QP@C, F38젨HB" [!` 4KH8?67 ?ÈeG7h.cȓ?Вzg11l%ӄS d,(DK\;?QwJcO+ߒJ6WNRc" _o?4E8%Q=>I?潢?trֳoݧw??2pqZwLqT-aY etL bo?jKki:g̅Q;EM???ǿXh8k`IsS56mrL?dzg ׼hi Ђj;AB IP?@iꭄhzj,K=6K3>?ghG`eN̳8q}솞pl={'-gmV}?0A<ܕ3#KJ{sadC|f:[Ii/H?3,>u2 #"ONJRB*%b:#SUSJsR ʋV2[JgsB?$Ƀ"] Y3q39ͽb?IB9_A;S`4h}?LC1 !MZʱ=ţndY?qC#\Bf\*+ᚒVS kzMʀ/f ]cj᣹l ,'XbJFҪrT4⚾j%T*pE,"wć{tTW|?|I-pӺG1 Kג[jaI?d䭪LT!sEzAƚśbm*zxY+ X}wigo 7WFS0 `?p;R=2p#ٸ+伖<9mE$p=UĄNn n $d٨͉t\2tD?JuU"δ.[y$P aiXC,>`Cdl2=ڞ@H > \J#A&CBAk@h-f/t̚@BgہϢQL"gA??d:ǤsFd꺴}x/?ft1feMU(y t X]I?raͪ=;w\??%Drq3u3Xg\V}۝wS=瀦`oh:.Ďmm?s?ta<@dr|)ےLy:8vĩq"̰Kt՝F$R2?Z֤)T%;vsbbdϙdVr?# UŨ>q.bPQ" h~?qK?{ǫS?t~v9mW6S -K|kiy'Dd1 }A!}3ues#U6܀ЅAH=ʲɓU|6tbɏvSkp3H1Eive^li?)ѺlY#g?zri0>:Zwhaɾ?'?fx8-WAQӑCi7xY}0>`t=K/27?%-g<ƺK`ԉfz_k¿%IVsiai%S,OH?/jX??<%ZWV\Cz>5k[@Ki!]df4j&4qct?/M2k:$+iUK"$i5kd?"? Ho oNOEH7 [ѮxuK[SPOx*h-n e,n ? xq[٦At1L fFGu ѨdKnn9, ^x V?y;OX?[[?&Ҭ(Oi=<2$t1_?M뒢E^ P ?[) J^T5QBaeGiCHPPk{z?H/ßUýPdm:>&+CpZ,CU5MҊ?AUtF)ͺȩ"!2Pd.k!_-hKۦs3$Wu>?KԂ?o]n'*&E^{q?I?K9TZ\$?&#?wNژma]_]Jq)Xwapg/拾u ~F^>lvhbڲpms*?O 6Xj֦M{P[ځ[ߘc X³^|el.CY:8N[:r\f?tG/8?5e\,F<"Ӱ$1m, ^HqgF2$}x ǩ`TQuQE΄GZ)Y%YܨA> p? 0G%Y.lwS֛Hh{bd$M'}S_ϛ/ PCl|Tv||???,w~v܁@ͧvL dIB6Td~ gceWȓtqQU4A( +qM!?ױ  CIW8֛=? EK BXp#XaMB\,چsY\O! ?S(XA?:A*ɫRYL}Wܣ0b?h d@uOy? nΕ?my bQOk?-mm|ʤOB<"֢?AopLP9Ck!-Ui?kYoBxcl-T>~x] ӃXX??޾+nu-]0vs受EÄkIԋQ x??Dì.?a:MTTTlYAK΋{\*~/T?{F[sN+:hJ~e wr5!KY&,YU YECtM NUyU7'0 O) *l;z; ϝf~K _@Bu[ NWs5ά??KemΑȕC??]g-G?樬p j41 v"'fƂ+7Jy24̎YH?K+6 NėDZ;{#a 3`BERva&w??Ys$Oo&D'[?#]h-sl = ^ja`)?h[&! ?3ї^?ȵ<`O~lɆ DLV9WWxMdVkvg? :9? Q42)VML(?1f ?90pn?cLZ:k%n?mlI`jkxWyfKXoTIL,^W?c;?vvUg?^F4쟾w]?[jJ_80q3u_qO5xzW.l@CR\IOZiՔ>{zw鐳~z9 HWT?2ZU?vfLI?ûoEFubbvj}r ? KXPV&UG]dBgBl<; hz$m?rDy#` ",?[ ?||(~eqdP TWz*B +?Q?Bk6L@?Cq<_ߔ^O\z'c[?ػ_FHUlcDz}?#Wi"JĪt:p췯|4: a'?/1f*+ ϊɜq!k?i}CI#sIxbDk(f SciDx1żLhcL?`*MԴF@PBL1?9H,_gu ӤHNt&cm&?'RN24؞BapC hPn4^h@JhEd??m?fΛ??PDa?,̥tҎEL7X8Ysڑrވa6acEdm)bÒ.rU)}r("dłdʓ?b6 >;fG`*IAeD?䧳I1 YPnT?F'ϭy1X&qgњ嵚Φ}s?Kj?? Ivu>yñFP֫Tuf/|fkaWv|ǎ}:qC_2ְkBwaa9ȵR??f ?4oy;6vYq3΁ſؾ`i05#R@]b ߏ?p䣁۟ۮ|zk送Idoj[Ə~2|iDVcc'/Wc(gxL.Mo{Zh}|B@>৻Z!@&] ?2i`^J efL`^ 04p yQRi13ni֩I?uE?{f؛jg'6㦦7^e>nhni9Pgtotbq鈿~y]k5B!a03?12ư[}4ƁCB;;;bD(Ef$IRheiSV`=q4Z(0JA䥸Xy\"L?bI)|?)(q󸂺)*ę߹c{|F\D%.#}9|MBT?ߒѿHx͔rRg?―p!nqo ƧЅ JR?UbO߽¢dRzeju} B[(% NrTWwrVQsP.2zZ?ʗ~Z^U?:?VZ?ussNJZlf>;f+o?R^s/#Ի`dF?sR^lOZr??|܁n&q%@픫Gá^%m-HPr̯(?*Y?x>J-4G/%v [n%_GgúS[l;}n?poNá{-{ꀇ?G:Ȧf4AsDYr4xÜw4?hֿEQHe$YY?hivE@F?W v|xD|r{`2ţNڦVי^,l[R#Inw}s㶦ϗq?,E k>aU5{byC<@mX@??LϤXG`ZxCKp\JL is$Z_8YøHڑNyɺEa)L\-ĭ[+)XA@¤Q?Yx]gc?iA9D&OX*MBn!cT@nMªBA+&s%!ϣ"q9>)t?mPЎDp`F҉ 0ٝ_7wv[KR?dU=Y`a@\),"">!O?i*KNi{gsg#Dr+3d΋Tn]OSq#Ylm ?.:_t{C9Ṉb)/?1YI(`iueRiFt-PBtJHSԓYV*72Z: P?G"n?ENbEՌj1ʼn"E M>46?wos|5y]5>E';a?u~[bNiGz/o>D{7EtS l0?@dk6Bx|EvNE,?` "N:c#?ᾥD`UԪ?gc|Kxh#?L; iJǐ"?Q]?/T6~JۮSll !s/?n~|vYr?Mme_.8IAvN?ꃗ_(ov_دɣd@<䕃ƖfP1́Qv6kcN6W~2guOw O? 줯W7R=I?>GRbA+IiurlOc h\Fc󎆳-?JjЭ?&C hXmEj/Y?<@]벧?Nn7?, G!8Y}uҺS<`"6 =6~嵿L}wdWt.?Yq>jw hx_?Pu?JٚJkuKLgd͌NT;6Y' \et~';2EЩOG:8 v'mu82VMۋ? a?@*ǃr[ҵT[Z}PHaiʤнĹG'9tb6Rt(??ya?I䏾TZPu 022GWį:^ڞ돿xJE4̛JKHw~_?֗pxqnyOcO"?R?ʙDPB#Ʀ{|F~p\SkpsI, 9 /?j?.:PLRq?e2 4QֿTZW{ii&>m&xzgV InQeuOt??=vh\#> ?﮽ ?,m|п<wH(ؚHzX|L$t?HuqQrd6?RټS9??PO* dHLA??_fHv?z\zS7ߖJꉪku(d tm)tA??3e\A(sjDt?DԞT,vq%Sڣs?GLFȦStBu@d,%0)^BxX\zx c22ٯ&??$iZP?- $0 4%vb1f`0 mmY?[K?KdIdIjv%nJm_(3<̜???P ?Z4]LiiirG/zY0-̥n %aosV {UC %l?<Yu2v `9s<^al^nQ ^8#]mC?Le~ .@?mG?`h+0 S? K#Ry״ma$hHb10:X&S<5fHl4? tC=mٶGG fx?} fZa$F

ӓo];5Ssx׎8nxYXCkW??čMq{٣{ʤ:? wڮd)p騷1x#bHTk*r*9ؐkɘƒj_O?՟\,jf^T FEoCc?f8Z?o[j?KE?*`(BNƫ߬T~xr a"d^eY`՘͚~>nK:9֔l|<4?O??%XYyZTH|Xb?Iޖs4 2?aB3^!ZaOE3$>ʔIw;$v4ȯѧHh|觑i:?ͭ:Ƞ s> Y& 4NE=qb̺j_ ?E{uRoߋQ-ou‡o!?B XTd?L\n V]ՙ:^ds Z}O `e???P7cMr#fi?2H[WYӂ,9@dYBIFtu_?8uƞ=g ,’?DO?<-J(O?lBT@4&' g'iԨ-gL۲?hy@l 8qw/| HH%`lw'qϮFkBwk#MC?xRiG, sxww~?X2&q)m`Ő6Y?m&N>HS֪<_q>Hi@ ?+?<4c&y;\bhL.PQm\/?I?UWЌPtYSYO1SݥՎ4 t#? " cHa K=d!{f{} L*ss9ϯ싎c__?\O~a@sFm?!mƌd[ܧCn^:ee?jȫ[Tnu:,1hS:quDL?Q麃CjRRΧץ,.3Κn?uk?γ;V*2U5W\RY8a }(m]eJ'kmS?M8A\/fSs_|W^|љƮ&'$b+m?l`9$I󱘀?*aZ`d}gZ?ҷZ * _,A!‹NZ[LU0d-E*?GSvv1l|n֦xw!uZ?k{?O}-7 iqbXa) L!^|RlnJX gP+g+? V=(~xhDenfV:דzRX͞%WsI2RSgPbBw{-VKaeMPup~E,mpٮZU|\f6 6s?^$8ˤB)Iw {|Z=\ˣU?҄lg A~:mZ}HzjdU׳q?xK0 vfaڸsgZi]]Q EDd?KƥA`KcNԭ#{WcMrcoY ƃ~aŀKON^IjFtOk{G?V3!pRFR`"a1qA4)T_?k?,Uڝ w+{r?{?2 kpVo:9hx穌^IvOv뼷;٪bJVlYv[uBC!%J!lHI'q.?8q}OǞ3#>H`y';_,~hߏ}? X_D/d*̥W U(Hx;? yˋ{'n>}r_SK??*X'S#=@G3Gs"Ag-y~ ,[0?dmJB?za?|8-FD؜KP3J{WCR?sIif0?KG?z/he%iHUUrR\?o^>|sM@&K_OMbH8Wr?-L`dI\g $B:*ا0?]6nξl `XJb"ĥ"BByTQaFrEF??(WREQ?Bjvidh t@ۑqEBbˀy鰕1CCa?2e#6DE?նA{bN{BN?!k-FH*{ I'e?=g[ӧH& `q1?lp E0Sa6?{" H)LяΎǝ{ў.`~D1?V0G@DABQt?^6EJq.G݉BTbt6VF!?t G>d?Rt.s}WM2?]z/r.ILY/ ڈmCλ˨cp,?DĨ;H!/\Ltvsx?hI79{ B|.ʀ?F۵}?nZb+ӄgeg8t&ӕOJMkB”G6v_ɋYԴ~|½HC)}Wީך^\贾?ҾX? Q{ `u4x7?r Y?Q٤ǀA&2?K N2qi?hr~Q?|y_T?U -b`ٙFbtz?VDgp TH qijLLʄyAЈdCrBש *Bvj?]Jr)*\??+կtvX"%p G2?R?U\ pK \bW HV&]{[9xժI-涧WB6Y,Ѭ?J"R],?B")Y0&D!6BٟS?EA2QMߧn~?(h:?JH{ r\p La,>h~6؍daο8sg?ZCǺ;XT PuZ\@6Q("aMB6y׼??[;={y\yz-1X0K?kŷm,yRZd}.?|^mfZd'FL*@1hm?$e1J0?[LzZX4Ϳ?(p:뛄z~<2SC6PiC k pqr{@Y"]苵_sLl<O?vS/c}ɸKĨ,d:piq{v?v0YJYVǚ"l<h(,R)e? wyKڼTFZ]g?l|h w>76am:Br1/GR4|t另;~n??GD- @9?esAAi YuNQ+RKZ4.brLUH?S]~o~jII?Uhj?0~41:ѱpGu?ֈL7d~?zpzf:9u-lF?#"ôJ N?+`F5 )Pe?u+N˷@ E&`[Lo2iJ"O~8~2OYxНZpC^߄GtMY>;q,"?]szǐa|FSsoZphR"$ Q?Sd<昂k4?x|?f,["@ ɤ?e} *?cw?zCe,?Ӡ?"1V@j}???yHPbE(oQm?P#Lslwkz0`&<&ls/V?ޭ???Rkdo:Y}hQ_|3Ss|/-KHvpss\dOVY?ma0V78_t?2MB?@Hb dHQxl|a˗lɷ%K?˺ϕV{JZ}H|`g%ݴ@2o,,vه2NL2JS ǹK?r?-W7&xa#eګ^? Ia YHc_TXMd|i`?_~{7T?J\4i?eV$ p?7JD%6!?& (L0f*@$f$>U?5V_AdDLEaa&.&E6&bFY [:0Y8.fYHq!ӞY2aaa3c@ޤ& 7?ȿҏ??x<d1"+\y?S\P}8IĦkw"8sk?%w?Xx,GJSQ Y/VǥWlр xxu9(Q@j5a!Jj1*nӲHNf\UH6U!os?V+?K?H?DrT?} ʥ!q'xz0g3}TS)?>?o [[Jx?Xv4JWv? !q nHKx?Aq: s4-pKR(@{B74̰]J(gʹmt?"?STT=$aEՙ?ْ }g,`Jnmtw̻ė2QL`t"*X?h\V R0_:h?c!?G?/ӷҞx?^%1 R???VDQQB e0'?i?a?HZCOk 5j5?MgNc]KXpH\b?  XJ?xJ$!6??DEJt蠙|{ϧ ʹ ء/eW}s]1*Kly:ͦNjKNNX븰T~pȬ?UyjwɿnU\j9\ '??^؀/ PNRJ٧ݯZmּO?<ا?fbp qowlDdkuރeDHl-q?]#?rx{k?8|a#{M@/׶ځrz?> K|÷`H?? x)+r&%f0?"M00#AVYQwG?9+?*vvg?H4\1Vgj#oz4\q &@e-}}a5n3R*"yMXuH_ kX:%00w޻h] 5DQ? ?xNf(1~yܻ{֗^O`i82kA:}j__iItt2CSv|?Ƙ#`d$$nvj/ᣙ?ҥڙ[?~^yY?e]"xΜ)mk Mh?+:4_r9g!"vY$K?`ɠ|y?j]S?c%V?6r+xB^XX-밂oJȊŜښxRs)۴`Y[ dc"R.meŐtKyVIŘF92Ȧ1y;nUW [hξV*鸪K swOG'PL HHJP\6?M:48?%Wˢ^QRI2i K?X:(jEՆ?WR KiG!>E@+tLMoߎ?r [ lm٩k䶉?p^I?DN^?wSr'2-_,YHYk7Ʋyt-g?lcr`DMr|ћ ?57Om??? n'ڵerO?@^&4)=l}B?J2?L;C!Rb̤]P4@+I}anr?S*0?!?R?g?w'tãw-\ܮ1pspO[4?yJUĢbtJc*dsbt"S?t->u;Zj?^WzM?Ŀiݬ1{PZg^t4:oqc-]q&_U*bWx';p[ ??_ztĦbU˗&Nzyt1; ֗GO_?(R꾂: sa1#Cq6rB?@օ?WѠ6v w}ʂr_Z:>mmX:{~kk\?ZMζ_k:b=oM.BUp?e TP/'t5]}ա_=?{t???|_Nt=)[+~'?wAG0-@g|N?1P8?󡾯.S_6U? Z˺Q-I^?m96X[]DWؕXߥ``*nlZ $$& eΝxqiP1}&0حet#qv`?}?];i9H5O(kKąϽ]?Θ*P,@giH?`,u??aOۻÏLa;ώEhxvU  HY?0þ~v{weev˻'7qbc?q I?NrJT{TkBI%& "8M?pi~[?7_priK>3GћK^uF[[?v^?$ߠV˨l]o煈%̄X 1?Q ʂ?xx6"WjҬa٫6}Wo+.)3ϼ6?$@"kFKŚRXҤRYu`shE7q?Z?he??Q/ ˢuNyZIK|n  vΥ|?"% {@}d\kIy?yt 2?hԮ?n -&ZR4Z;@L)ДLS VghTb2r@ ??UE?rbluDحY,]YrUgar( r("•p $!!tw:ݝ! ʶۭy7;U~鮧~o=`u mKP?ֿ< j.^mt?zZ-z4lY\LHz6i}6R' hF.k"?f TƸSb?P\LɀX qXxK d$?qs⊾EYxRipåMѬtL3l?(?==\UMtMvw2HVl??-6Pu^Qu\Z҂ KygA<q_)?jUD"Ofngx\\v\6TFىCnGvKD?{_^_]rڵ:>A;a?blD9e//Z-)<>z7]~baDRi?\?wW ~<2R~j&l6ES?@? ޕܔ5>EOD?֢[Ћ2<i?:?vߚmC&bv8,nGcЋeDuZʍNMi0@? jZ ŤiY6&MqL?tNE?}_Sn-mot*:UNA4?.Kc?IFm/'?EFY:~!zj:ZܵbbRڹUI?hc??`a(ӯlP xښ oΞ7(ut][WBc Zmi xfQ|51H:2ek TJ"dVsL#nLkr`z=mq=?F/ ߊ? ?j )ne|?v:Sv*&?Dq?? YeCT~pMnRU0rSҫD#Mx}0{ HviuO M5vL4,X03OϒGs?ǥ? N f䇙B>0h.|OOlh?Q?? YAWg]?;'aCg xj@U#Gţ쎪?o@P$a 1, ٔ}Y)yu䬩Js2 ?~E 0bB?X"Qo< `W?c ~*4+}=ut?\_?Jw~/}oӕ t+xՌG q[fܧP??AwbGeܫ^ݩWC+J:\&?Q:Xvf8T-ETNFC?^ xJQ|2ņ}6q(X^Al?pC_tuioz;|V ncS~isYSo}h[X8Q̟"P:IЩ8?bT f̯G[tH nk{Rn,Ko_{#[

s[g}zP ?_j4???B?ѲBEّIݘ#KnElS`>$O&v`OZYl%yB>?lPtb\͵?7Զn7uT?LfԦqimuzmQZpe\ BdGBBB$$7r?e.|wUz^=}swowథQ|PY+^hEQL]ܥ?h]Z|+@cO[Q5ٷɖ?j'}_B?}?gyhkL(rDkAd4jF2s aⶢSⷔPLedCc?j}np~x?Xą0hJƩT?? &QkhWɜkєjɚK?oSUL7??3cMU:9c9վk6] h3@$)DO?ʒoq;T\1u^߳u׸u{|#vDl[I@CRar !??pT8y?Oi1XLrNC? Me 3T"^㬓b", X_FҍCHd$akDU?{@dEY~QL?e:/s?n?:ĭ}\PM znu[]gWxPd j<P-1?[LG?z̠D,esto?Zo&P|iZm~.>fթZ$Sܲgi,MfEZܢ5(HBIv5N$-ٛF&lD\#d? b~Y28ʊC '=ϾuwqK=N?? o']/ESŹ6Sw!x>%R7}HZ v1ti>|t@Y{X%;?.j.oVf~fk UMN; ;ք_7V(nf?暣AlP@{Z4 ?vc/u7Ύ=OO+=GuUGƓ?UnWV_8"/h캌Ey4RNrYG}QJ/_h%RdiEZýվ~01?u?X4cQUꮈ|` ??2;1?Xcag db[s?/2V8bVyJ$HC__0\HK 8KB&cQo`~R{Wl%ԔxpBVb6GT̂}h^niev+Z+ta??w.Y~ďqڡs?\ٔDSm,8*RH" ;'G^j1u?&̘f۟f?i`f,0ҴFQKt CfQ?td: ?P??k`ˆM@#ܤ2"p/3 ΐ?Bؙ ~INaZ;fpE1~ hWrV {?Zfе I׫?:j"KGL?>3ݭ#NifڍUDdQYY!dٷJRI*U?IU$,Osmfx߹TUwa?cc!t%?I˾?:,ɟTG00J^6h~r5ё]uߤو)rlFHfsxy0 `:78??r ^I?mHc[?"?J@W%V]gTfv_Uy?@PE U$?{?n;xޥ^t?mL'EC*K#0N'ʭut٬ھBBmiUYٽBm?_I*w |MyDCEjig???]7v?PPS"LaC ϩD[?s-k~ hQ`;ti-_$'I^˹6RP ??d`TOTt-My3dξaIk+ع ǕrQahy< Ynm쫦?}grY`yX?(?&Oy?ŵJp H7gLޯ4[_Q~ aїǞ՜?5$tJZ?ל 7՟^>4`t??S?qUXELm|?}ƕJt@ qt{&?`XkWa05aᱝZ|뤨h]N?Nz˔IBa֢;K>P??9h|tKX]}n?cZi8+zRu3?\|Ym[onCX,L?4[;M?kZeC?Iv=:m?!ԇ9 }4u?"]A@0?R#/n^8=UszbJ?a`vCـc>m^IF|FaeV_tFiH6RMyA Hbm?Rјd\4n#Y??,H?VGe"3@ЇodDv{k{Ϋ KʦkVO˾yRl/g )PKB~ ?ؙ/e61{o ?½e38(*e{p?m w/;' ƄWP ?H@k~ΙN?Xgb, ?Vp|BNlI~e ?& 2|X^{H?@Рׁ@?eCr`xY?j_Wk WBӺ?z?9:Uϭ`-͘yuv>kE}jpaR VgBa= ȯKg@gsv]ẀyO?{iNY&ڳK۠?rtF`Ga[q1Q{(?kq;H ɡCmQEN\뙡NMQ]??| iZm?J?tj"}`k ^RA=RTn#g0OH?ȯ%?>}Ŵn(FO>F[:LP?QBh]co#?cX?yTmDlD>jKЬ yŌ3>\i}vMqK?oX%eٱ,2ϕSZY\gS{dӐݡlye~pmobhp[N_Oz `?&ӳe?2?[??&5d/.Tg]̕Nۯ?UZC7=LF??Y,jfo1?8ӎR?q~+&̻dKuX dr?Xw٠C z0c֭ ??TET;臌P?ӷ12'(y\#q8u|EP _߇}h<\|d ^*dE@.?@f? th;sC#^kح a^G=UrVV1mԽyaT&>(Yrn[kXuMHY?ZMhZ? E?RBX?'Zly_7FeISHە?OZj<ϘS~yO|$s4N@ԃL~ "??w C=i{??l0?}Wy;? )O\bFKMbU!Qo\Q.I*tMpg/,zac0Dd+]7V:o2Kp2bO}Bi4 &D,i?  w)VwK+M[E+vc@Nc??0PZeYV?_cEŚF " ǜAи"NQysp PtˊC;&R[W(o4 \\88&VTUmr/َ?|^_UU?O;=? ;tW׫N^?\q|܂Nr*QxIGWqypU]vl??5MlFoO7^n +Aik V,/uUiuHe(* Ğfʍ?Ii?Ǽ{Ѹ׽sVs~x Ou^QMx?5$s- _SPPEFt]?S!2?dYDits1 qY KA4A4\:cdLn%4a{VsaZkM0Vo ?W :?j C0 6$\<{e;(Vī"t|}dJoIi̤)x.|i=4$ fft*F??OPEI&lc$?|M\ggf,յ[kT%{bWwzw#M6E[ڌ8d>xK,Vbh7bI?w޽vc]ht[>?w?PfU)>?J a.q"HAj?nLTN^?d`]t?HpG?A`sU/(k1i?`` ??ӚH .?K|'dEooY6#laRi&S]da7D 󯼲njWE/a[T30Σ#^U4l#R(j0LBZl}6(!FԿRov͢ǐX?o?]+nщ?/UuO?'B Luo'?I'4?҅DK[ֱo[jLwO,6^q/;][0 aEZ} l@l?wɃWe-L9,cM9@"̠fn!a@ W}ӺkFMT$_yԱ6Y4TT\~500|M#j4zag9?|q IP p?ȿX"a3u㘟@?>i]{BP2 l |_Z?˜e06c9a(.?Qlc\b?0?"W"H~ѬoQݽ}?yw< .CkrNЏ.t#zh?ڽ,M?W@aS#oKæAO?:?_OMi?ufqquP%\ ,r 9fS ?@NtN#`?d׭Z*>]U]W8 ?MQ=qH`|Xis0J Նfg5f^żZ8 &??f_ԶWTvhڻeUKY0X*[鵏jN`quWZy~:,0L?k p[8 XUe 1?dڭ`Й qЅUܙsY$I?v|NiXq0JQ9?(SDl Q2bZ?(BJ FquzBu'Te IrFl? ?]yXNhۜ ^Zq(sg`@?cPG0@x X{fRN\&I*6Wpk?^?l_AfQ]?vYi;:ëF?$|.~<<чaܛ~n?o? ?gX]SfrL?z;N"SFT,N-`;MQ5 D?H? JvM|Mhj S?xX.6o~?8 K YA\n5;ٴ{fuA?iYiA[{ԣKXJ`c8 YtoGzIl?u)Ŝ{nSPԈpW}rAuYwMW[ztV^_yGaVo?ŠoYe{εF;9_i|Fjfuh_<2,3Z[}bƜO 񼜷ΐc }?f D bu5 rHe0 F?ES>Fjp‚Qƭ?R??bdq\8b=5Y_:0 ?]I7ic^{ܪF?vt?OoPm2O =zh2JzP~{fg[I_БQVꢠD]S\dܥ5?b(Z7TQ]};}`?`͹s{ B?.+ i_?O-6rJEW~*? d<dE٭=? Hd܉]UZ~zS/m)XeɎbX?? d^U[lV3? 0(EV #??s'\H:I7I:K?d|sNVsާ?*?ћI s׮ kJ @ʖč)yZ%gW/ j5{.Ȧ}9*ǚ {dV3i<=iu>-?]T0i di`0aw?,Ib35yKq?gt龂`i}a`W?z|q?A?t%ǟ-:~l9T?X|p?4l7dEBm???M A?-$-k?WۖG˚s՝Ee5j볲UQE|X,^,MCD!° C:$b ? (qiGjF+~>?? 0ο w??Cl[bktSPe+Q?NUؘ=|_gw|;{Һ@`!}?^J?,W fEkSt.Eu?{w\p6Z{?( WS~tC?Lv?a U%?D:H٤I?BgEhsз`}鸫'QBCW5w}j%#`j?-\?0vňߣOG|::xtaF>׃??iqfX~ꓓ?1;ݯS8eoϐ &K4~:? FgΤ(?"QϢ"¯(.Yzuՠïjɷ7h `f׏?n@x=T}a fc"Ö^eoҶ?\?jJ^x_iK{??[Α??E,?R, h4el%͸M1N ew*w?o]eλ?;y?b^zG?ً?GˀҌ8UmOlѕ?$_$!Ո#?2pT>t$QG6B~P&lBLc@EPt:Mf2t&?tNgO.vv?dlRt6 LgdNA[ؽ`#@?eC>bg'1pa ζt&h c^?q?JW?P[EH:v,#K\R}zɣQwoFM[?wL]Uc}?K뺚ǙThrB?Qùx瞹_J@ŀ ?rknyEI?F؂ 2E2nmd {[̽KrJ^ig;yM갍l qe?ǧ lN` lh6jF@nQn2:bsPTD_G=a? VFySilm?;;ŬxP3 (* " "" ^HPK@Ѹw:ttwBH?dXo?zy~oDTWN{t[kx Iq6`F<{?6Y?_k9ڰ;??V*?ࢎOv:A2wE,8^OQkj|̧TjJ+~Svx^_^nV- *?;_5)AI?F^X$w5M]x!~yl^x۲TcݸZa߀v 0ކlMw=֥OObXV3\kd+ آND=1J??zHxJ2`KoKS_h]IWwv5H,zbN褁gvkmj7$hsƘo^ϩӍ?v@oXBAsS~mT5et[?ך~ @?vD_McgN\ ?DO^Zڊ\`iE$e?Wh,?^;6SWn?w?R^?W4K/oXVURGdrV?es:?'D7I*NS~VaePN2k㢲ce?XthcizqQ2p{FY.n*_@^>w}bc}%?Xʛ̌d1?ro??Ku婚;?8,?fJ}I]%2Ӣ_o\a Xb `K?Y?i*Lh5(JIѨ[FuZCڀöD6a׳nHȉ뤡&CUL ,H 1?*Z??P aJc?6"vc҆#߂{D :Zͷ*o\鹤k>Pn0?`}lwN9[?bPqU|;ze^5ev㨋EH2}R\;n짿lU5߿1{~|Q?'uJmOmת9O{\> _:CzX"!M8ňv:6,]ڮ;^[_ZW)kbB񸝢, Iv{}ƶϪoxJ}BfװG@~I|Jfwgf-0{DR-f>?GB!o͕8^QMry:wpT?? K"dHv{cBZN~( ֞b?NʅַWw Ou?^i2?Og夽X SW ;N˪:J|ጬቺIMC啬G4XO?Kj {*VO,Wp m󬐏h?_?Ri:7R)Pk-!#H@ġG:N?l.ӖKurqIfrlr[& jVg&J.JuoȌnQ 9pVv/0r?} wt-ծۈ=d_d1+\arfyڻh "p!Ñ4i?Xd~eJ1u?αhZ /.]??wLZy]zw}Ⱥ~^?gZ&?q 6EiQ$X4k_ ?bf83Sp==Rnm)5 N=ah,3ͷNI[3-@?^У ^Pcqs"VPSpg Lu`?hl H??sF M?x8ZaYiuԃq ?aшNYFb3p?Xa??BMx́A(cx][5\T5 uaH@&B5;k?ɰuhuH>Zq'?ʜFVRdmuT vha^k~+{=˃Me4(?$`/9p'?t?Tlt2ǥ2.b?lQl͜Jљ4ަR2I*d0\R`1֙}ҎfE9D8HR4GX !e??ZLigsFg s?1RcU﯏68G`tgS?6_9Y?t?}O@X?u.ᷱ3 &뿛*U6iotX&fE~X,o,|^8?8".??Ekޏлm|m_-i5_YHw]76_V6RI9lr+lgѭ Z&u c\?58f71|O HJru<\{^U6WJ?L?XTLxt`o|xa4Ølb+OE]?bC3D'lQ!i4CR?eF?~?{3?5~s?ЮNf p? 70 tJ??"S$͐d~tr4鼮$?FDsI*kdmN w1Xe_v4?33? 3(? ?hȑ $ wҝttwҝCSٿ`~sz|VXM= +q@u?a]Gx܊F^v>?htt^B [kLu妻 ?yfnyj7kq*>vJFzxҰA+fq?[1£N\ݭ4.wz LEGlo~/-M?`o`XV erzl/W4Vyc( P1Ya҄|?DLʛ$m}Yƒom\:&pds?z?mt*?Ju GJW{mʡwm?t!qɼxHFT?_>>aBv2 ٥D`˾w?]ZRALgiK?%v&ol.Ger"ih?E7uT囩<9e\Xb;nm8nZFPpq]R}oZ o ?zViHᨉIӆ̣w.~Y b\wD5?-Wz/\t)??!M뗝a|qmGبDHw3OTO9 r?f!8?BIC LoU[n̋if ζv djvT?u6=^Mc80#+P?tI$B  ޵xЈ{||q$( Ef9&?/ŽոsNH3錨heG?jͱBB.-ByGGNf3l? JgRȅADH]?  (M?B o֩p1DZGDW- 0'9XntYF?=IDSM7?}5Fs/"}ٺƎ?i]YC??B驯T}#\l?W}6??YTO?:dʼn>?V}>m{XS93mwDNjtlaew;T@Ӵ}?[;Z")3:dsp1 gJ?l;Q\?<?cF =U\uV+?ׯ?̘o }n?p{˃H(%{nL>{B?Ee웃a?ay4ʹm=-鮱u\Ih?Gc(X|E5xLYg7@`'VT8AjI N6Ke|d?V%d ?Pvkj?]guDXy5zWehbߕ؏ \f?Hd@7T?Y^F]rP?anw˒nu?*5^-Sv]S.C m=3p5)d29Z-PhҼDt߆;,t͕{ |XMp_{-?9U'Uɱzx;Y/?] ۢ1q 2 *'e XP?̷G͐qUj/o_qdA1 yМe)JhN P5`ܤXJxcI??CXP ?Qڼn?'pxEisGBY) h $?^ q?4nmQQ|eyt8ia3$`Q?r;Hڤ}9 ̥B1?pPyIF?Mfs_u ^u߆z.۞g?_WtT[ZYr?ƒ/h]Q\R:e?P_jzbYݝ3cc~zn H;xv-T?:?St}䯋دӧ&??j_VݙuoKTAoQUGK "$@??$;?I l3s]_yǀTs\#G?1mĦсփӏv}aqMB6 )?uq8zq?aQvczϷ۷lx࡭F?.#=BL?߫i??5sWhy?HkGqzU>_z, D?HroUm.?bOTG|h 8$Zg&lJ?^_SX@M>T{,log}9i?E%EKa"gDEN#hIIׂԜ 2bREYϺ4ϧAʥyF#> jWrЩ%X\G0L ¯_kN?5^خ?OW5LNY{d\W\ޭ?>_PXހ^:)?TפWt,. 3F?cAى"Bx hW E0%FT>h]epzkzT١}^L?ϓ1f4sɡAl}???[r$O#ny3?А~yfF?"fzV:?pl,0VV2zŽNXjN͗ퟮ=iյ >GM}N Vn2ڡkgܻLnm9X^eWg֡.|X][] ?yvywrv흣??1sn]v%äk|@>gZ%ĔDk)(!S @$[)@XaK>I*iCg(u*h7_~_u?Y G'qJVB?z?zʼ LB OGB  e+6v_ G Zc!4HagρEU|%l ͈z`O7C-?[o(H?כE`a?ptwaƋe? 0ԇ_iW^;?Kq@`D痹?E>(ѷ@F`6pEbq6I[b|V<#v\?02 ¸'nO߳ VuHT1?I’yQdRiN?D8$?̄*?>I[2%ݕh_%iHJ2өMJVJ(g }$d"ud?M?K"{?`XO\pT[OyHpîn?tAV+}?D?8cI/)TGZM7TvO>+(ڶIm@*f櫎nZbxyٙT@pj mQ3>pt儩| Vnf[TlRTTLj̐Dv9/|qP{`|???y eP1S׾?u-Y>r?_R_>-1F-N˶׆HtN|?s9pz(j?t6ZIbkk^gQyNԣ J˗_\7$oO5 ^#?(N$ˈ~?iͥx&%1> I.ɳ&.mRO ;f7ۣ"SgGi `Bv*y?rk횪MU֖2?6>91_ⴽlv? 4W_GkNe܋I4F @❲E$?dو\>tӳT9l EUUL1_lslJRBVV#S ܞk??z?csAɈuxNo0?o?JV&`UQWPdD?!?s1 s=W===w IשʾKYSOUCq?㤎LI?K!?el+Uw?['xiA]5S4J?Ď sm!$i'gs!GVSvHZ~PzHtd]T묰Hv{?4;xh8!Y<|f'Ke`-~ {\>K!YM[ zE?m]/ o}?@UWSϘtifxx$L#[v'?r?kr<ا ?vU?}w=^鞩q FK˶rBC|E@M\#MI?X *c@!J9\SVUsQhؓNlSO>{g|EDT`nLDӨ#GPDT6?ڊ1?l;'d\?(LL2?ATG|FiK?k1 \L?~sT) >Px2PF?jFr^WҠFL?X1SVGO*޸6G0?AJ?aS,ťlZ?t2/?|0b8Auu`\ndIF`v?ypJXQs|cS}8gƘ_?a`94-l}1XĄX^f"m =lQUjm SC??eZ_&RwIzȻ#J.zXxбews=0᷒ӫ 'uV?\[]-R}5+i4?Mc0߱q\ok=|?9^b{Fzϼaj\1MNB|.WR#/mERu?pΥ;~#xJ}?lgvgnJ,q]"ӃR}Ysf~IFTꠑVӥh '?AqT?R̿ٯӧ6?@:fZ;?jJlW8ؘ`c0?ӀF ! Jc%JILrvz?ξ̻ei?eIN` I&:܃ . d׻4ˢ`48Tb /Q?A'?fs |J8rI JGQ B.f7@CW @ ?<&T7,H `vkX%̀kM{Ry*8hm?ƛlq#[ExP-5tNWۜk/]NT^{[? /1>?SwɁ۪\Ct?pGiE?Σ%/#Ovdr ?9A6QL?XuOM w\X+scSQqͳS?QeejXey6J=2sYXvLW g Uvv?VO(?co?ɦAV뚽c?Z+*]j-Q/7t2̐V"ΦN2?mT )|}i?/v{ߴU l+L-pkM?PJJ Y KA@?Džo~{PSR yNM"_^Q k+SLWWzEYR"s+u?5G~p []uQҀGmY7& PuGxfr\ ۽8j$fFGH}u?iiUE\+yߵ5m(VT֝U0AuP,ɰfDwoM@Z9RV?ݎ{~L屎ba:l48?h9I:?BhT?kæ ?G:?BZH8hG[iaT8L?޵_G>M&e vEkUʟ_p,Թyc[HqU}gkZfG7h*NdOo?Xv63Y>R;ٰӛ@ecRT:?O}>eK}TN *jP׹X`y{ '?_?NT[4 J{{AUDH_qoQ5wXP\^|i@\T:KR}Hk?fY6NLօ0Xch?Y{?8?t"%? >?)|bgy'4=er7;:oFVk!ԼЉ}Nb?Rmf@![iu̶Z׌~ H`,J||ß}{^qd?7z'oW?Ww9Ft?t?PStnl = SeRE}|SRQq]\ÒC?_?WB4?xq:"Kgn9M3 _?T?݊? i,?KpE7lLKT ke wf??oΝ;;?[ɭl*R)TdRR? ?k~i]]UE?3<gy2?4 x v5+MlNѼ ?iq bNHU3vgTD@QePKF@%1GCtWIj}kzꭷ??DN?Oݷ?wz l?>ڶ!Jnx%xS "?M?tAEAcQ)Zwk0Ԑ~(sUA?b-IT܈%DLn n"j#d?hM |{"9Ɵ˰$\}ZSS;Ơ.KsFo[/k?$uĽlȒa0wbP;l?tc~.0t1رKkGW\|e>~g ,?dUWʾ[|i=19 P€1BL?(PIEQkrBxP=p?_xu}T -6nM@}ec='G'S;?N ?M{93XYw_mYRm]w3p ?x*գGBއq[,E':}m?L#cU6x!@`DžMjH?e{nHp?[qzVT ?_SDcvg[X#܈h<J̼xqr?r >R?RxVW2?J?\,AenC*a"~"O6W.?5Cvؘ ilhDbwY6ti6GfriP Ip?PtProV3W!$8M14N=Bu=Y3nU&` ~QH>?L?˱ Yya^Vu½M:a?EE¾jpK]plE^Oo?lH g: ֫j[Map M謟?,ṯQa???R?sgKƱ&TAbU>?, -uB#H^iۘ|C Ta?rǷZ?c٪~V4Pk?nvg̻3u%ϗ/? Yfq L`lfO Y p2뻷D?9?GsKu?dfPй_oOMdy?ywagwYWDGATA@G?rK $~\:k'Iҝ Vu͵_uu>]S^jFD?Z(]?r[?ST? ?R1vttٺ0s%P@ I˯%ixl}6" }L/O?OM]?28X0WoT񏎙~]QCt?*=/4@ҷMC}ޥHEkNb(?0SA3rI4hXD_NjϮ?j2ͱiH? FDd?cL "Mbr}s=hM1$P9}Yݢ06X>˲`ID^eOh?auP^? ?Li(@s9\nn߷,/VB-?=v? cXrmi:`AQTREgw qA;λYgZ?ڙOh}*R?W~=#c??ha`R3eS2%c u< یSh_\uO{^R.U ]m?*?^hүԣe^|sp?%_9r/}I^3?s?QnB&g \me:^HomF8?,QMO}gcr~t?Nkj@ZTʸ?q,K޾߾B{|0[緈J?=0Tfjͫ:pCoGPjki?ܳ4W0? :f:7}c? `A?L=?m' ?I??)?Z^LL? 6a?8(dqJ̸? Qz 4@qNgh?E RVSkqH\X??:J5۰¤jV??d?*݁JEUR?qpF`Mc.Nˠ_FMg `xoSi[gQxQ`_N5ؑHFܪ0 ~*bA- ? ۦ%QRQ+2Ɵ?Bz*zBzY?Jg? {Vb'$iEt??İ?vkmus˕泪Ghb}vƇ?x%X?V&)}rthm?{ä $"c O)?Ãxxشfxߦ X_tkϯ[{~?]uԵx˴>k?nVEXUTVKQ [ d??{nI@y?Ι39wΙ|7lJ'm6^ɚjYϞ>?קEGG c䵞^/s US74B5+WyG?M7ߧRw.QǮrIc$| c@aUc9i2b?$"{÷x8?o<ǡdf^{ra?^#;u@dh]uQ8r-S$AQtfP10`?idD ðvG7qKU'᳣^=D?طqI??U"je ?!xZHƒ~!/٨zfc=ұOnKsD߮p6zmըk:^(TjsI$\UUv2өX*IK]CwL2.^.ު$S}2u?K?nls?PL(l$T+j`4`6)E?w;KW 2!Q/jsYŽ?Å M @Eѐr?Y;s ǥUHQLlƜzt}F[9UiU'EiMw6~>P?jQ7&{8??ipJ>M($B¶7Z0rU5|Y#n3z<W X~nEܗ?傦~R4>N=1mƾJc{;ZslvQ<Ӫ"Dacaƥ"~M \.}K]zp4Ša,gLt q5 q,N2?D Ks~NQ[Z?C \!B?x<ĩXi,FTg 'bd pgƦ ?n/Nh 3?a3jSbhDzeX;kU䵅 W?Hc 쪉;uh}RV'PQ)޸X-W. *,\H;ᰖ~Y?HUkG{eVk'Me?[s׹Ų?z1gU?c?5qLY~^ޑ?3<ǘi/Budl͗?kWeSW]hG mxRfj5V5;`:~?O6W5[?_e|hd ]̹cIA?Ӊ`v0d]2'?3{N?܋P?c?iQ1?I`f23`6? *̟0h,0yd?)? YwcEMҁx-?Sԥ@jxj]-*jFn&<ϻ[3ޠc>jh?+?(GP|_?)OV˷Fn5YŭRJu|hP}hm?^yj V.A3[v0%'vmaPP~lF`: ^z*8?> rɎ,F8 Qu{dX?M?ptN5G^x=B:,d f(G:JH~&fTOM²ApiLL!}<X?%h2ኺP_[\P?/T= +h45^3Ici{{|vN=?! Y?74_^q)]~gKAR8> +tv?pָ*?3֪޻j? *e _Xg#z,#&2ֻ\ssw_)h {Dh`:b:Cwzo8mLqwHoCjX߰W}i OK(Cָa)aY|?YĹFQR?F wlv??èWu)0?28_ioyo&r]Fӧn/'c?`?8#$X1? #18?4*p'M?̸Mm# YMEH1 V V.- y9??jvuGUq=t pGA@I#a`LarwOt=Mf}q?|_uWwu=o v q aDp0Π$?.'n0V˺ހ:X4}dǬIiV aCp H:2 ,?( KY}|3?ͱ?Z9+)?t[NEA?c)6a Uh?%̱squ:L/TGF]qlCM}}#L4<}pqȒ?v0L5yB}Ej?:?ԣfKEZwj\g0_Yօջ0RΙ7f]U!ܽqKXm>w B]gS?]~)O9jQxޗV-}\im>l??l=}֢y҉(Sfq&)?Iƪ|ݷ\;`zJǖ?k.yR ?տUk.Uʲ*r4B2?lgɭmb^ w?C? Lwun6_ K?fqF@s7=g>Ϡ" wTh:xrI&lcssĨ?0A95z*N o ~zt?#wc݉;镙r׹M=vMPp!h?/뼷Ub~~ɚc WI/^kr $?1_?XN?l_~) E+`7h8N駑ŎxUڻ%K^ )? C>M +d]hJi?lڿus^؇]D?<?_/??K:&Eϰݤ +ϳ|J?]So\w눶kGusFݩL zkVRLU]7y}a;|]:Mի۝|M.vs[n4aX~hݻ_Ecabuγrqi;/)pqfscw;㛶^dA%k| hD}ݺ$Z_ygI 𒫋⋴ ʼniP.^JHIݒ?.[Ar]5BiShK sT;J !IwgB ?4; vH,fI0`ȻeKmY͒a /1??~AOTO,C? ` tׁ͏^Z ԯ B]?4pWq겺BU@`[>Оrc]އ†UO?yJ, ?x^lz_jm EoTBgΙǗJ pb_9X?/?zZ?eGjoT|?? ? ?ڧZ#DuDVQch'4f*ewک.|j~\C!F).O4OD{Tliԛ?Ob ls):uJe,o]XysC5Zd׏?k}v葽W\b9hXf}yO`s:`9? Xpf?3R wp?!1j€}眙{0Qx?&&y??v%H4p1ap4%l>Ʋ .&|W 8E0ŐGTSfK4J:r_!кn!a?,h XkVGZh? MdHb iɉos1?5-jAME??֛?up?3n?GzS鯒%?B 2v?]&y7G*wMz-Ƭ~?wWlo߾t?ucA?+bX:*(:zt\sDTqIyd, M2YZ"؛??IQą򵸈Jzm=b艱Z:ޞ/tgB vI{ĺ?\ zfZ=@eEjimǰ章+ + KO^f_#c3?̕]?nYzz_10PlY{}UwRr_cYON<:T{EVpaҿ߯| ¨Qkr7i?7f()d:yK W eл@ d8jKݛkbV"kW H,n%Vmg]j2?+1e[-c lgk)0cɻX|mU!D,hgW?KEi?a= F".:SOC%1~?:EH,ۧ-mYfk͞?ft*OMymz7@ L'>ɰ~7-(=Lg{ YP'd鐓n+U])Zw^6Xe#] aa"zi=8$"q"xdxV~?hCo1A^ o\3??bDNU9L~?E%rTRI*?Uh\tW\QEWb (?p?=Gt`84kʏez[uY{*?'S ?fg|:Ubss}XFEe*u?}xF&Ci2{Ў}럩n9i"Щ@aZM-wEϻ?ӵޅCϪb{sKf_D ?\aq,ݩsוOY?2G?FZ+ĔB껑Ggd(@uFGch[bF(?63'dQBV(Hez[tZ0eD V`JU?_i.GC di\X|S-ƼvR9^ ?api. Of=NbQ??EBzu9+Υ(23 [o؇OHq8 - H??|xi^+­(xQ3Y e aϪ? lC>d$O Y3/ǿ8?\?,Ɇb?S^**u㥪OdrҵJ?V\.SϚs?bAxYh80Y\utJ{?WW-O5?ѵ?IlvSkE?oyo8CY{/f XEGj:_qƾ|ə;魷{ۯwvw76M/{m4y#4찛ynciW?lXآrb4]g͇u?4m_? vwO~SDֵ M(Y1 x.$o?1?<<Vl"6 )‰RE7v+j?5u?S6Ma?L5{5lQi]ek;jm@\&zz):h?W|(?S[+M_zhU^QzRQ9`?c~C*pM?< ?lԆk_M|k JQ Sq/Ib, ,E݌koA&av8C;'VZFbhd11sv?wU=p\/W-v!H?L2Ezxîu\<S>/[i!S緽xTCNNe@Ɣч?m!9$^&?1:PՄB N10hV+IB|DdC(qX$?IZ(? Fȱ|pCZ  \a<V6v]2>?tx\#ATMW.wuq!N؏Yx?P6뾲<;vFCX1P??4gڛ޷ƵaWtSS^nPz{?;J^RC*w]?`yAIPK `DU\\ scn=wOtgAVHķVթSN;O[Nk5shdӊfi}bjFIVQ^Vkc/ę cy{ ~M.gU_,L]؂y+V[lvgPv\6;zA9A Tn.mf"?w_cP_dt0R}r\Qj ?ó }h-BEB4C!* ?g?? ~,?4RHO/C9i??JbZJ VeSb/H?3OK?77Wjm},l??4܏1$ZݱEÑ[kMT?\?jF-^VXCfJÓ!}kW \.} Bb_̍]Q6N5_?7[.כgnMj}:sZu׳_]3[?v2d^[zc[ȿ+UW|AqBon |||QHԻLp֖f?BR?HfxF"?C?K.Z:E DBPʩ߆a[ou Qr'[͢|GP3}ktdSKWsGw?m? ŃTgI$Gh<^S0Ha iԩc:%YՌ8_>_v[E?AFـGUhԚ?}? c/} \ßh!ѺQ5ȧ?6w˚kہMUD3?l?QFfYDӔ?BVQFckhl#Njc?hZTuLf eoq??_oM\gևәxIڔքƘ@?/Bllc`,|EƲ|eY]+VծݕZ]-1yLy 9~ZL@7M2P.AfIY! \ePau&/H?ҳFzXŶi}veg|RLjqlyrwW?i"-v/ϳ,{? N"/әɻPѕo?^9??؂?<öH ?:'K6.?=UE,Za_9ny̮>i.k=geֱ2PQ sG#Ɔ8DǮ?ĕBa)?\ot4ˊQTWR??BG _fCČ# ̍C*̷h|?}[Tw~FaV8NGL+lcG4S2\ 9~|ת?5[أT ~ A i͂??:X`NS$QA> /Z??cb$,AHH3?FQb?Ùh ?qi7 s!?gޡ!7K$'E`x)-%S"}Tx-_N9  5px8[EO5VkmE??` ݎkw]gUi?к%g>zvH^'MH9?Ab?vh+k-'px uR ^iBY_QNE4O?ڒ3ESEgi??xj~`5VIYpP?T?_?-  |K Z yY"`&uVtu?m?jGkv7:? \?ޜC<&i2*X fzY ?“^Υ ? J0??uФǠDƂlVbUڎKkOzM n~C4lFꇞ҅omf҈ s9?QShvZ@՘ma 9rŸŕmJẈ]c[>^Ӱ۴u ZwW5}ͬ Qg伐|?3 ZT:˪`cl?j(bTd1qQ? ?, -K裻|pNnk^xUd*j ?jLwJ*IwOn?y^ns<l{ cb㓳vf&Ynw>'f*?0 Ez?fe±@e?l/z-Ҽ>=>AlɔL3@Ky`'g`3 '9) X+?oȥ# J??y|z k7A??tkeΚȮ?J&e* ?``cll`[^XdˋlK»emjVz@R恷$Uju{ntw-S4%G" cBB ah)x9N`E)< 8.FI EJJI`;UIdoЦeADI BMiHcw9W??bZUQ=?(?|mXzzhN}nE՟_?]1mTHt6Idb^t\b$_ls~| ܲfq"昉@w{CqzbU:^??b1`mݠ`B"h؈ZʻnClRӏzM"4Ma5@ @~{b{k}X]=;^{x’Ljn{k_69ښJH\sII"8tM:9>gXA2r*ɥ"w5WV4V+֗cڝK DL3\2mR0?fIn;?&w`I6Da}*^Itj?HeUlA 5k՞nNe?2'?| fv2bPH稀9)C7?O_P_?cZ?}d"3A)PC{kS?7c~xs3FxnxG{*+ܝ?KOU d?]M_@523O^E1F\,d]˵_y`8H*n ~^VP3JDiF.7?6^9멋?4ꤶ?C?8<"vDr ڣ_MD+?gL]Mju rl@ 1|>S;efN?]2ڃCfo^>[txYUJ/cps|Rc?wŝwtn hz'?F||6UN"}:j?tmi91Ipa~U6? 'UVl.bΚ2yѵ^??a锩?OJ~%Z_ 2?rIԥ:j8͋D0A?DnKi?P7?P vv:|df6Oie?8"bD898bPV(Ff(1bBn }hMFt&֌?> ?oz|?uG,>jѿ/󯦒,3c?Yόݭ͸Ӷ(d! ?@CB,BD[@B$y{yK@/uCOpsSWֽUS1a@ݔyM?bf0q(7?lmN2`ll~?k2Vg uULzZ!gf`nv!nC߯vZ?Fj "}jY?7TUvL`|8%?5?4O/14?VCiKO3IqNu/HZiW? 13^ٔcDX&F܆.E3A/yʁnc̰mn|`((ܐ<>pjinXZ$ y:̐d&H|әr#w'? /..?(?Z?}#e8̒uTNeFޥE!j?=]l-Z<;RRڮki<ã-ɍkxЦhZVuڧ]mjyKR󳪭Ykj~IiWGJ??iFm[+T?uiMrqKQFQV{J}ɢF}NթoojUJ;t]FqQoX?$`T?Nb}J^Ja+\ _X?(0/&/SL`8^ B2Avyt֊?Ny?㞛ClAm MBtcd)D.U^OVHe?J"?*2RPʕw vvZw!.Jw/u?c?V3єi`ֵ^eio A?/㣙A?#? ƞ??zbcwlrJ|YWٔ:w0fmO{-hwE?OIA53V9I+O4<ɜ06-PZ$<^̉y¸nIZVz:`퓘?mdB4ff m L;}`/~wy~3ON-|_ޏe?Z `?g񸛸9?<M`ǏS|np@A[xx+Nf [ p .w;O BpV:0.vAm\Nw B `F ?o;O?b ԍ FT?k;tgxy B\ȼ0CÄqHI'Bb(5oG,sFlFQk ? f,8(A3Rq0 x YFPiP 'v&?ˈ vcabtQQ8Y?DE7^jn Ou[3hMٷ.?~_jrd؟yʛkoT(T]vzpi%?#KRPͣcbL&w ERVOZ7;;Du?iWK랞ȟ?4MZi .DJ5@M-??̬HkiMӤ5|$rycO?zO??OZ?i ?zqq1¬{WooZsJ|>_=*^?MףOiii9u?Ovvv>X[bc2\XXoD"94DZ?i \.GkpvW&imm~Fo?cKggf8shi?D?}|TZuRTsN_Ooc\P(Tϩ?KZ?i  ߀tNU h޷Z rTTzu ]g2FLJ?MZc a٢0@T V DEX@ O )?I?II u4M AL$##V@@ #??a? 2?w bYV\h+a?G?ʚ dNE廻u`D??e2 .Y"lJV;t/BށD"׌Edž`Cw-wmEp6]ޅc+ ?q/]a zbpCq B!Nj0ZqX+OO~N<=!8c8bQ܉P\.? "ş)bB!}m>99 p&i۳_~ }||\]6Rju~_?U* .jb[X'ΔWWW^j X)ӶmO?B!@9>{&R??mueVTZǍF#JH1 c4ou}~Va[j?Bauf0V/5qr0Lpm$NN?n !BS,at|8HuST:??d2 ===[őFf)?HYv}||~?V?QݮTkS[麮;?18Ko !B|?(Zm</lAn h4s&YVk VPa?rQ:P>kX,h6j۽? cwZDv5B!45-{@?a¢_TkTXN?XFV?L˶mtf鴮izTkȮO!YCq_? ۩jT !" mJfVUu> Q?ȮO!? hC\T*?h4, 6.TkȮO!$aGja#'R?`-D?OdWS'B\Xd>t:? # aEQ`=˥R)rнjT !"^l6q&j4XWcŶt:-\EUէöO֙P !sz^FKASKNJTk|O@?B CvZoaxWP !CFQ?MQP(eYЭaVT뭑]MeB!m?TU5 bD"a뺇nm_P}"?!Bdl?J HRY>t_jT !"m bD"a뺇k7P}"?!B$e0@As\$dj8Ρ'B!Dj\׵,VQ`0ϋ -ZDv5B!g \.DOdWS'B?v?5~d?{xxQy?˯O!Iu]?uA~¦>p@ 1@"'&NL,bIHd Hdo2抃81qqDqOְ+ǿ~sO}qeZVUjF{ݤ>Ŧ=}d֖e]\\,ltIM`7BP?O.t\}l67dz_qh۶MG?XԪ?:cޤY͸V)5 sL&K֦Uh4JҶOͧu~8g?nZ]EoV? lkr:VZud?)͸hfjjuf}Ut-??XnŋmbOk5p.߿iݻF#UoTȃ@xČLd2|^?//5f6fVmj/..nc]m7W?6z]WMiUPod?zrU3@mrBZǗ$Kx<^8b&v?٢(ZnmV?kٌǒz4As~ajҏ?///[[,W{x,iHkyKJKlV\5?jHHkyJwޅasrP(RbZ&uB?|K?mIuB?Z]n} |tX,x?~bHkYJ>ijګahv]zdts IHkY~RWo*je)?t:=_}ݳ*uʤu6u~뺵ZͲ[TZVZr9]t}Hk[&z:phEQ''' Wŋf IHk[?T պj5fZl? v.N~;Vj]۶s~´ze-wr!|FFI6Qku?$aZW*L&S(tNN?E|}˵j)m~$i?_LjؤuB?]?:==U,YBn6ݿd4[V?J)cf$i:Kֵ3IHk{([˗/gcX,:snrӧOK\1IZjza ah4n]4?tĵVֆy/0yO=?miO]t}K>?jV\?f5X*?A+Lkng2mg{?_ 6?߿{3<`E?_yZOSq̞nf}o?F?{،n?RrjWYSZ;=; Jl6nk:?fg=88Pz?V{u^RTiPdRDrh(K+J̴~u\F 7L&jP(,zz,n/]Z ף?U 7j3goo ^\\d}Tt:?۷o 'inn`:gN/ϕeJ%}L&Koe۶I\}kN\6sjAAf\9:URQ?ix<vxxIwl6jTRRT?Cncaөjjp>. ?q}Ui?@ uBm X J{zz(hg?T*eX,Pʚ\]]BQ?{ OIkAx ͦ~?jeJq_zt}0?_?OX@ VT *Q@DEEhr ^rWlҊs?'8٤\ݒTX D@T Bz,t^ofvl@0juq F? 888y:jPtEQTmuJD 𰷷g}qqW#}0lunBu~Erwww۬saD딈֛Ru]J%\.?? `]%ZZbooqsW_c*D딈q0?c~xx.֛"S>?oi:Md peK[uJD3?}T,|wvvJ2YXWL~?N?lY)?ru^7ϟ? ^]?wk`])s.o?ZDNoR(Jlۮz{zzSjo)tA'''_~Fo%"ZDnZooom&}?=?` `v?_Xcy?-%uKO'g&Z룵o?ZDn?msZ=|FuINhmJ`<+]+/%~h{ ZDh Ņ?:\NшANhm?;W?uJDkzvmb?#Z??\OS"Z[gu>o4aMl KX-uJDk뒌lo^?m/dUN^:l\_|h ??kQnZa^Ȫ?Dk7nm/a֓?4Bl?P.+BJ?s 5թZ׫ֽO'h DE2 U.dU֓&}VX,~SXPV3JMSF`</pov{KzDtLVSan7UViPS9?gQjMfQtk+EQѨVIV< JSv?3Zf?Lbj$?WSRk`?'}ө]*޽W(AO\x`zh=nB"z_21XT$]?TUYQDg?Ұgu}?C*I'Zo9APmrnju0,? G?dfXL7Jr~LMTj?? 5kf>BMuTwb*Ԝ?;Q`?0fEk-ICA ?"q+!'a[MSkU?MM3Uk* ?b*o?Zo9ArY^wyyiDž?th}}}mnTZ{:t:>noVӦi3?g5կXNLJEC\ΏPS5jNLs?l? ٬B??hfnT`{:DfXL7AAZOXү )fPSXCSP ̺^}:D?lP(~¶da<$K|AO ,004(XP -1TH |tJ=) +,0(0400ivn{nfv4l|78߯ĕ?d2?_tg?ahVj6 $f,BQpf3I?ZiZXro???i,qVRp?>$|i?bqzr (zߓ^FzOBb,tEv`-Oq@"(ZAH?/=?k-Beek͛[h4jXI5]ʣd6RZ>0>+nl _ֺh !锣p2IwnpjO9 iyAv)} $f<.7)8ڃB!*==-4}i l!.zj֚ ZY> ~r~}u0dV:>$|6bqzr (L DEnl ]֑nZwBNNCJ\^L#HZ8R?Yk(?`x0W[fgggĞ?X,?y^1IhvGXIHJ?_e[Z>[ge%}uBQT؞tz?KK;^_}}}],]^^a s!?:ֳ|L#j.VѝÇ|FBq:vW?ڃB!*Y`?`v8hlvqqSb? ~⅍vTMӔ_ebBDߪқ&`K\_\h !fD}|j L&?77zh48ϿWg:6 ?Vq`} -OҮ-Ajl?ѝÇv)?ڃB!#].a榝{@zOB?]ӥEiI+tǡAXLZh !bׯ_u*XIHkG[l0 ̍SbHxx<?)8ڃB!Dt^,,qV?pA@H?|H)??V?CԿhZ A!_:ؤu*XI=\?=i?z4Y ?[a?Vfy@,1G{P!DuHtsss~EvI} !}4b) ihZWq@,1G{P!DEX,{{{ZjuN|Q^w}q :ֳ|pv;ÄѶAE%c$VAX?k-BT?M1feW?Ǹlvw'XIH?]gn !%f??ьG㟭MJe?BL& q?~Or: :ֳ|?a}Y?L2I!AH?|XOgYk(?.f?q8:ֳ|/MlXXbx<A؇$V?bqzr (?b;vuuh4?? pX??I8B%>AH?|XOgY,'ըBx)/&3NBٌp<p\󻮄uOB?yM+N#I4?yX ᛔZ?tB6֊}lB!įyѰk{{ے^dhGQm}հ?M!Ȃnmm?!y@g??qz@D }xxt K[NſzV?o?LG? bl?=~B[B!޽Gq~u]f?? 0\Y?[blٛmd?? qM+gGY뇎_?O~Ϳͻw?鿨Yf ??h"o E )"<waH ?\peH2,laHc!6KH!d?>J& ?̓ݮt~SuG5?^l!?Y,?TZ?In)gr>dhkJey:ֆa:Z7u]%?R >Mr%B(iRg0.Tgg (I?FÛLn?Ϥ'%iIƫöbֆa:Z7piJ?` %Y8Jgg?7Z띒Ţ=omKj߯r6- ?D;\*IUxSk? XL狛.B{wRJ?9 b QPR? j)Zf@t.jAP?2]d;7HG$?|>&oLk6.amjma|qb_RO)cd@I<A??^wT?;űŢ=oKj߯r6?COfvT\&??lCM ? cu0/nBr]Wqe\^$&y2\zѷqZtp?i4?+P|>&oLk6.atL ? c?/nyݩ)?%}reT? R?ɬ"~pSuGպN%y{8p_W~v?n}2 WˤtηooM ? cu0/nA@e(ȈJFV?Sj%x4v o2?ϤEiI?أ^Tg? X#?? e8q׆JeR:);_W.Sk? c]@81"jccC#\nmj=_ EY8?}Al|~N?䈠KZ;xopBNM&7 gRY>7?̓m GJө2sajHlnnzsz zP( QaO\.wB?JQI%M2d}dij?p_?$UFqigK;Lỻ/0p gvw?ͅֆaƊn?@8tscj=_Re(ȃ@J%J#evxTpvys?PƁG (ɓɍtepijK[-m GJ\??Y6ZaL,u}WxLjǗ;y{IrcQ;Ζvww_`a*5n ?G<𕩵aKx_UVk4M99? ?ɿMgJ}K?@Y.??I)\p~SuGJ (ɓɍte$Vƨv?_jѣtx5W66fjma?Zjf?;? 6Ʌ>9M@P#}?ˑh0( 4v&G]zYRk?UƙqijIx \:q|GM}?|WZ?j?Sr7T4yKJ%WV?Sj$?3^Q#a}K'?qfiwog[:q^TD? XARZ?bgB6 EIs:?qdaj=_D?K) fAR +`S^ ,~Y*D \Rb?Ƥ0$nT?P:-lrJSlBSp??V_1{g{7?Ozɑ@+iEWJ!`8џ?PƓ\[qijX3T&TeҭV 檮?mԞֆazt:[ӧBWVV$I$Qc_$ i7 *U֣& H<OeJ4GQvIt]??MU?Tƙ^jI xcSwԴ`?\ql?{/mOSk? c[- ??a? #SBL) )v^b1MkzQ?d\Zg%L?TeҭV 檮?mf?? ??Zxڇ%tldej-T*7oȰn3?@ Qe"1IbZollB0_jLZc?3.^Q#I?q?pD?;jA?dŽԶx?Za ~[Or?Dy';=[VgY>?~ Z?jqFCs(dS O$19v t?^ve$VƨQbnjaxLAZ?.jjYRFSk? c1@u ?kz\kmmMmzLr^?O7?ꑴϟw:h r\f9n ː<1BA) =c U?!IbZ}v#DSW\WF??GGH&NqfQ}pű%? ےa7R ׽]%Qj6.FƦg?E٪^?z4 Ex"O,S@_F^vIQq|jK#?fu7qo0wbZtSPeKZ5:37 ~N7zRpqZa ?sxx8۫1<Ly/^h g2d7d(2nW Qf爲6tlZ֎ G?J;jAWsű%?LvR3^cKFjL ?}*cr?I& ~mq7 *Rl ?< Q1E.e`]?O P??l`z p?J*p? .ThAgyx??sϽs=g]UqQ$~~Y#j!p20iRg2D L!M睬atyzK{_ F!JkUtS)_XXLj>R:3z4o,aۃ?ʐhmX, ijf?T*}ן>}Ҏu' tZ~1tɵڎJqC`fFlVp VhmX,Q-@Ydp۝C{_?ecOBto?XXLCb>̼RUlJ#dh 6CqsoaD_Fkbf-Փͪ.Fvrz f2wP0}t:-+)Ҥf=5ܤk~Z0#;uKU\?Ɩ?\g'7XZ]D;\[?:?'0Z[,e4?zz|%*zERxPeR0?S?G?l&/?}*Fk??ӐO5s*cJeS:EFvXՈk8M:%ɼ?Z[,e$cn_E:a.SA@M':IVx|7 eMhy^y3Z??Vq5[ $j;*mǙv03VW#j6+q8W!p\?bXF3˗zbL&[B!$?uWZBߧr]) ݤk~z?ZiM`%1uY?ju TmH\(a9Dfv\cX,ZFqppNm}c(1Ch%LCkȭ{ Ek@t TCkŹbX,#˫{_>bnwQir9estSJlEwP_=Jk%1uY?ju Tm%1\(a9Dfv jAnmX,hhFiQ*ERoll? !MT? kzæ$GI ?֎=jWa7P/\?bXF3Z~^__}3۝Coaa?a9bX,AQbih=Cx<._ C?aLr0 iR\ ]M-ZCbǙ`xc>;+3W?I`(Ρ8 ¥?X,epT*ѣG jzǫ}o`p? {CIoO-S`BPާTrQ > nҵZP?lՑfԨ_ƠmYN)2,!S ,DSP? kp[. %H RhʔSE .\}~&KyA޼&o{_>v*_ER?r?uQl#վSɲv{E3VPV6ӪqtωM ?{F9E?~`%rj}~~v_Ϲ{R!ڞ^wK?83=1F_ ~]f 3??OS둧v?+z/?Z Vy?pxaߪ]GѥbjmaОêcccdjuGg[[T8?X8;)J _ztLGZ*?*2Eks<6~pʹ]M ?{JK?L_\\L{_^1JV_˒h0+)&2IAw٦SQ$?`PZ3?tFu9j08[yf(qF&WZ?ֶ0"slβT%~p?|jWM ?F? ? ϧ=ݸZ?$ =yR'i?9HkK?)Eb?β І.Q?W_x`jsv{ERTj?@pgMZ#X?#Q4E??ɨ8KUU?ݴ6? ??} yF`ud{ӕ!T,?coo::O?MYT*})EbZ'Iq^l6MGHcnHsTj?͛7z?thXK?1Kh?MZc0Gќ%f~_Qq. L8PkiE*ֆaƝe0iuZŅի۟|Uk_tX%FK?U[t^J7I~/厓DNgjjnH[Tj?E>mL}F[Kr?3a~s(R)mWq*Yn1ZֆaD[??~0joqkT:qKZƒIJJJQ8˲@jjZZOޯzFd??63xKUU?ݴEG]67Za?=:1 endstream endobj 64 0 obj<>stream Hn HHH``` @@@000@@(P``>stream H{?G\@\?KItiɖʍ:j^Ț??i?B/Sp8pz?!  "=ФL EdePqUŒey[@G_d<#UU~UOh?]\ +W\󏿹nk~㛟˷n_)n|?~^rh?91RªUFUhR~}cV?!߻+l|R.~WC$GhL֣rVDy:/O?2mҢ-B~m˯6B.ȭxR IέU2vk:g~*9?L???*sEE?0g?[ ?ԐtxcJ/^HUХFVq IiE$?&KH l*t?s̸HM?y~?EQ@as*?!s`{ء?򽻟/g YuP k B,k~ჁǃB.ȭxR I%,Nȗu~\?Qb0uhQ܊?{^#}?z5 Y L@ OVd~%EX=.^X~䣻^:?(_E!#A`CrT6[ȁy$s`E:vh_!(ddQxg2Kud~aBh?jZRN4ƪUWc[A!#2M,dR.4y.#@xz_2g ?t?ohR Iαo<\z\oWu~\+[BFC\!?@? PH& ْрǍ?穂z>ng/As<#2 H@Md|\P?db1H3qA!I >>?ZOekAA?5?]?CTku9{%}2 Hg^X gdA|~XsAhygv<       e HVZQ6%VlYz :4Epe?ǐޓ ?`ku7@\ JzO6R?Hɪ@zKPӖgoAr%;,??k&?ubJO>PXv5?z?8XZ̔~?p!Uh5\NRzWȶ?>h5e]By?fҸlpRoAC*O:?T^BC?yFL??#CȓV6$dFVcPd P8{^m ْUNM}%w* i AD O֡RU#{In7z9sv`?dh 9h{2IINԳ?|HP@ḋG?w~>jxoDX@vdO BN!Z,? fd:+}Z}:n -.fWx_BpjA=Dȭ?PK?dߒǏwj:x@_[WBpdr ?^έkVK?7T~i{ZFP8 WxI1u;x{!N? iA*yrŜWfIG?%;یȄd[?t ?qa??}[?vjtuuJ_Tw#Sѹ艪^Q*'_lN?!pbP= <$=ϏwmĈ'z#ƮJot2V?"?NTi? qgD=,td?VMshQ0?bs yǜWg?r?{=?Z А?; |(u7FI)B2n#Я)F~#?k^Lg?JĊ?5 k ArBU~w~ [kM'o?yPŻᆖTseyţ0=?v@y?m؄7Ѩfϝ($G??iʌ2!F!cĕigRPk?JP9afacJEn&?`?N6Ћ,A|bSSIx!*?6j?/@L׫Bp}[|3 4PDoԥZB6aغ2_V=FaZXEj{JkoL?Cp`oE/jU?d[?qJ;y(H|%sqbeF]& d㌺P8 ?V#qjź U?H6_%*R?-\Gƈ$,@^Nc` 1`gd`LH 3X@DGt??J,*24Ej 5? ŧDrS§)_HStL?f'??6~On#tQ?LRo;.YY Q_Hi0wr.EiN޸nݰm- Utfí?6t-?+"9O@gE UU}y5ljqxBv|S'ߛTQ &ShwKn Ʃ \Dr?E(;V]y}il9iPfsnj?d*dW {B3bOj0u vuԖ?t'y]{˫J'W??sr?y [Oy7,оo{??RV{n ??n\?+rd[UM?Y?Y@O(V u ?qR:\Nx\euvOut͝lE5>(}Gx[q=.[wwa?OkY?!VY8YՆy0V" ?2v`w4+H{ǞJ?bx~????13Ή ປS'WVhlLsds%~Y0ȭo / ?g/0 IA?qu0`0gXJ N AŹ6ZDs مHdPy,B9?Yx|~PpEtX't P RP 'ӈ,{ǭ K = QYw?.h`0Np JOuSK|G{7?\-de䗊 D =;Kp* p|Bq2<?pd]1֧:?iׯw?t@/VOdo?}C?qɢtw<Ip%+ܗ_&&r8M.*[Uqq?QmRʜ݅Ed g04gzA6 Ú4vVٗolo?g0N~yGO7'o<յ9]Tz"늓3PuR?G֞q{w2Vm)U'??qHVC?rd8se c ?LUݪ:9?d;?5?ak?FRy H G~E?m6ccH`kT3p?UZiN0ťD}r? `IRNNTN?W ,?QƎAIk?p]? ?'CŻyPfr?(? \2' `0?q< wGE[dqAu( GFxO#YLYly/$N.` rM ɹ̈́?qkYK2%Ml>=ѵC]pNsX]?JpMj[RglFGcxV#89[iRUN9Y1Ĕ `0SEYTҸuɒ? ?2\?N[,/i[R'oY<8ďҫ|f4Ȥ吣=  D?;213O Z?4u>>N›цqe hL~{|? fp?Jj~f?vi1c=.? a@7zV?l܋{-Y7bo?BerHq,??[xNI1?:~_2 r?I|L`Nf?=0o?u,'{WdƙYB8E4 d{F| srS**32ɝ